Translate to English Translate to Spanish Translate to French Translate to German Translate to Italian Translate to Russian Translate to Chinese Translate to Japanese

  

 

Planeta Criança



Poesia & Contos Infantis

 

 

 


GRAVIDADE / Tess Gerritsen
GRAVIDADE / Tess Gerritsen

 

 

Biblioteca Virtual do Poeta Sem Limites

 

 

GRAVIDADE

 

O Mar

Fenda de Galápagos

0,30 grau sul, 90,30 graus oeste

Ele pairava à beira do abismo.

Logo abaixo, estendia-se a escuridão aquosa de um mundo gelado onde o sol jamais penetrava, onde a única luz eram as centelhas passageiras de criaturas bioluminescentes. Deitado de barriga para baixo no fundo da apertada cabine do Deep Flight IV, cabeça aninhada no cone frontal de acrílico transparente, o Dr. Stephen D. Ahearn tinha a inebriante sensação de flutuar, livre, na vastidão do espaço. Iluminada pelas luzes das asas do submarino, viu a suave e contínua precipitação de partí­culas de matéria orgânica provenientes das águas repletas de luz bem mais acima. Eram corpos de protozoários, afundados em milhares de metros de água até o seu túmulo final no fundo do mar.

Atravessando a chuva fina de partículas, ele guiou o Deep Flight ao longo da borda do desfiladeiro submarino, mantendo o abismo a bombordo, o solo do platô logo abaixo do aparelho. Embora os sedimentos fossem aparentemente estéreis, havia provas de vida em toda parte. Marcadas no fundo do mar, viu trilhas e sulcos pro­vocados por diferentes criaturas, agora ocultas e em segurança sob um manto de sedimentos. Também viu sinais de humanidade: um pedaço de corrente enrolado ao redor de uma âncora perdida e uma garrafa de refrigerante semissubmersa no lodo. Vestígios fantasmagóricos do mundo alienígena lá em cima.

De súbito, divisou uma imagem surpreendente. Era como atravessar um bosque submarino de troncos de árvores carboni­zadas. Os objetos eram chaminés hidrotermais, tubos de 6 me­tros de altura formados por minerais dissolvidos que saíam de rachaduras na crosta terrestre. Usando os controles, manobrou o Deep Flightlentamente para estibordo de modo a evitá-las.

—Cheguei às chaminés hidrotermais — disse ele. — Estou me movendo a 2 nós, chaminés de águas termais a bombordo.

— Como está o aparelho? — disse a voz de Helen em seu fone de ouvido.

—Muito bem. Quero uma dessas belezinhas para mim.

Ela riu.

—Pois então se prepare. Terá de pagar caro, Steve. Já viu o campo de manganês? Deve estar bem à sua frente.

Ahearn ficou em silêncio um instante enquanto perscrutava as redondezas. Pouco depois, falou:

—Estou vendo agora.

Os nódulos de manganês pareciam pedaços de carvão espalhados pelo fundo do mar. Com sua estranha, quase bizarra lisu­ra, formados por minerais que se solidificaram ao redor de pedras ou grãos de areia, eram uma fonte muito valiosa de titânio e de outros metais preciosos. Mas ele ignorou os nódulos. Estava em busca de algo ainda mais valioso.

—Vou entrar no desfiladeiro — disse ele.

Ele aproximou o Deep Flight da borda do platô. Quando sua velocidade aumentou para 2,5 nós, as asas, projetadas para pro­duzir o efeito inverso das de um avião, arrastaram o submarino para baixo, e ele começou sua descida no abismo.

—Mil e cem metros — contou. — Mil cento e cinquenta...

—Cuidado com as paredes. É uma fenda estreita. Está monitorando a temperatura da água?

—Começa a aumentar. Está perto de 13 graus agora.

—Ainda está longe da chaminé. Mais 2 mil metros, e você estará cercado de água quente.

Subitamente, uma sombra passou bem diante de Ahearn. Ele se assustou e sem querer esbarrou nos controles, fazendo o sub­marino rolar para estibordo. O choque contra a parede do desfi­ladeiro fez reverberar todo o casco.

—Meu Deus!

—Situação? — perguntou Helen. Steve, qual é a sua situação?

Ele estava hiperventilando, coração disparado, em pânico. O casco. Terei danificado o casco? Junto ao ruído áspero de sua pró­pria respiração, esperou pelo som do metal cedendo, pela explo­são fatal. Ele estava mais de mil metros abaixo da superfície, e mais de cem atmosferas de pressão o comprimiam como um pu­nho fechado. Uma fenda no casco, uma explosão de água, e ele seria esmagado.

—Steve, fale comigo!

Suando frio, ele finalmente conseguiu responder.

—Eu me assustei... colidi com a parede do desfiladeiro...

—Algum dano?

Ele olhou para fora do domo.

—Não dá para ver. Acho que bati com o sonar de proa.

—Ainda consegue manobrar?

Ele experimentou os controles, virando o aparelho para bombordo.

—Sim. Sim. — Ele suspirou aliviado. — Acho que estou bem. Algo passou bem diante do domo. Fiquei assustado.

—Algo?

—Passou com muita rapidez, como uma cobra.

—Um animal com cabeça de peixe e corpo de enguia?

—Sim. Sim, foi isso o que vi.

—Então é um zoarcídeo. Thermarces cerberus.

Cérbero, pensou Ahearn. E sentiu um calafrio. O cão de três cabeças que guarda os portões do Inferno.

—Ele é atraído pelo calor e pelo enxofre — disse Helen. — Você vai ver mais deles ao se aproximar da chaminé.

Se você está dizendo. Ahearn não sabia quase nada de biologia marinha. As criaturas que agora passavam diante do domo de acrílico eram meras curiosidades para ele, placas vivas indicando o caminho. Usando ambas as mãos, ele manobrou o Deep Flight IV para descer mais profundamente no abismo.

Dois mil metros. Três mil.

E se ele tivesse danificado o casco?

Quatro mil metros. A pressão sufocante da água aumentava linearmente à medida que ele descia. A água tornava-se ainda mais escura, colorida pela fumaça sulfurosa que emanava da cha­miné mais abaixo. As luzes das asas mal penetravam aquela densa suspensão de partículas minerais. Cego pelos sedimentos, saiu daquelas águas tintas de enxofre, o que melhorou um pouco a visibilidade. Descia um dos lados da chaminé hidrotermal, afas­tando-se das águas aquecidas pelo magma, embora a temperatu­ra externa continuasse a subir.

Quarenta e nove graus centígrados.

Outro vulto passou diante de seu campo de visão. Desta vez, conseguiu manter o controle. Viu mais zoarcídeos que pareciam cobras gordas penduradas de cabeça para baixo, como se suspen­sas no espaço. A água que saía da chaminé lá embaixo era rica em sulfato de hidrogênio aquecido, uma substância tóxica e insalu­bre. Mas, mesmo naquelas águas escuras e venenosas, a vida con­seguia florescer em belas e fantásticas formas. Grudados às pare­des do desfiladeiro, estavam vermes cilíndricos gigantes com quase 2 metros de comprimento, oscilando os seus cocares de plumas escarlate. Viu aglomerados de mexilhões gigantes com cascas brancas e línguas vermelhas e aveludadas esticadas para fora. Também viu caranguejos, assustadoramente pálidos e fan­tasmagóricos, vagando entre as fendas.

Mesmo com o ar-condicionado funcionando, ele começava a sentir o calor.

Seis mil metros. Temperatura da água a 82 graus. No meio da chaminé, a temperatura devia passar de 260 graus. O fato de ha­ver vida em plena escuridão e em águas venenosas e superaqueci­das como aquelas parecia um milagre.

—Estou a 6.060 — disse ele. — Não vejo o que procuramos.

No fone de ouvido, a voz de Helen soava fraca, repleta de interferências.

—Há uma saliência na parede. Você a verá por volta dos 6.080 metros.

—Estou procurando.

—Desça mais devagar. Logo vai aparecer.

—Seis mil e setenta, ainda procurando. Aqui embaixo me sinto numa sopa de ervilha. Talvez eu esteja no lugar errado.

—... leituras de sonar... caindo em cima de você! — A mensagem desesperada de Helen se perdeu em meio à estática.

—Não ouvi. Repita.

—A parede do desfiladeiro está ruindo! Há destroços caindo em cima de você. Saia daí!

O barulho de pedras atingindo o casco o fez empurrar os controles para a frente, em pânico. Uma sombra enorme tombou na escuridão mais adiante e arrancou uma protuberância da pa­rede do desfiladeiro, espalhando uma chuva de destroços no abismo. O ruído de pedras se chocando contra o casco aumen­tou. Então, ouviu um barulho ensurdecedor, seguido de um po­deroso solavanco.

Sua cabeça foi projetada para a frente e ele bateu com o queixo no fundo da cabine. Sentiu-se virar de lado e ouviu um ruído de metal rangendo quando a asa de estibordo arrastou nas pedras protuberantes. O submarino continuou a rolar, os sedimentos rodopiando ao redor do domo em uma nuvem desorientadora.

Ele acionou a alavanca de liberação de lastro e mexeu nos controles para fazer o submarino emergir. O Deep Flight IV pro­jetou-se para a frente, metal rangendo contra as pedras, e parou de súbito, inclinado para estibordo. Desesperado, ele mexeu nos controles, motores na máxima potência.

Sem resposta.

Fez uma pausa, coração disparado, enquanto tentava contro­lar o pânico crescente. Por que não se movia? Por que o submarino não respondia? Verificou os dois painéis digitais. A energia das baterias estava intacta. Unidade de ar-condicionado ainda operacional. Leitura de profundidade: 6.082 metros.

Os sedimentos lentamente se acomodaram, e ele pôde ver formas iluminadas pela luz da asa de bombordo. Olhando diretamen­te em frente, via uma estranha paisagem de pedras negras irregula­res e gigantescos vermes cilíndricos vermelho-sangue. Voltou-se para olhar a estibordo. E o que viu o fez sentir um frio na barriga.

A asa estava firmemente imprensada entre duas pedras. Não podia se mover para frente nem para trás. Estou preso em um cai­xão a mais de 6 mil metros de profundidade.

—... ouvindo? Steve, você está me ouvindo?

Ao falar, sentiu que sua voz estava enfraquecida pelo medo.

—Não posso me mover. Asa de estibordo presa.

—... os flaps da asa de bombordo. Um pequeno movimento talvez o libere.

—Já tentei. Tentei de tudo. Não estou me movendo.

Havia um silêncio mortal nos fones de ouvido. Teria perdido contato? Teria sido cortado? Pensou no navio à superfície, o con­vés oscilando suavemente ao sabor das ondas. Pensou no sol. Lá em cima, fazia um belo dia de sol, pássaros planando no ar, o mar de um azul profundo...

Então, ouviu uma voz masculina. Era Palmer Gabriel, o homem que financiava a expedição. Como sempre, soava calmo e controlado.

—Estamos iniciando os procedimentos de resgate, Steve. O outro submarino já está sendo baixado. Nós o traremos à super­fície assim que pudermos. — Uma pausa. — Pode ver alguma coisa? Como é o lugar onde está?

—Eu... estou apoiado em uma saliência bem acima da chaminé.

—O que consegue ver?

—Como?

—Você está a 6.082 metros. Bem na profundidade que nos interessa. E quanto a esta saliência sobre a qual está? As pedras?

Vou morrer, e ele está me perguntando sobre as malditas pedras.

—Steve, use a estroboscópica. Diga-nos o que vê.

Ele concentrou o olhar no painel de instrumentos e acionou o interruptor da lâmpada estroboscópica.

Pulsos de luz brilharam na escuridão. Ele olhou para a paisagem revelada diante de suas retinas. Anteriormente, concentrara- se nos vermes cilíndricos. Agora, sua atenção se voltava para o imenso campo de detritos espalhados sobre a saliência rochosa. As pedras eram pretas como carvão, como nódulos de magnésio, mas tinham bordas dentadas, como cacos de vidro congelado. Olhando à direita, para as rochas recém-fraturadas que prendiam a sua asa, ele subitamente se deu conta do que estava vendo.

Helen estava certa — murmurou.

—Não ouvi.

—Ela estava certa! A fonte de irídio... Está bem à minha frente...

—Não ouvimos bem. Recomendamos que você... — A voz de Gabriel foi tomada de estática e, então, se calou.

—Não ouvi. Repito, não ouvi! — disse Ahearn.

Não houve resposta.

Ele ouviu o coração bater e o som de sua própria respiração. Devagar, devagar. Estou gastando meu oxigênio muito rapidamente...

Fora do domo de acrílico, a vida submarina bailava caprichosamente em meio àquelas águas venenosas. À medida que os mi­nutos se transformavam em horas, observou o oscilar dos vermes cilíndricos gigantes, suas plumas escarlate capturando nutrientes. Viu um caranguejo sem olhos atravessar lentamente a superfície rochosa.

As luzes diminuíram de intensidade. Os ventiladores do ar- condicionado silenciaram abruptamente.

A bateria estava acabando.

Ele desligou a lâmpada estroboscópica. Apenas a luz da asa de bombordo ainda estava acesa. Em alguns minutos, começa­ria a sentir o calor daquela água aquecida a 82 graus pelo mag­ma. Aquilo irradiaria através do casco e lentamente o cozinha­ria vivo em seu próprio suor. Ele já sentia uma gota escorrendo do couro cabeludo para o rosto. Manteve o olhar sobre aquele caranguejo solitário, cuidadosamente abrindo caminho sobre a saliência rochosa.

Então, a luz da asa piscou.

E se apagou.

 

O Lançamento

7 de julho

Dois anos depois

Cancelar.

Junto ao rugido dos foguetes de combustível sóli­do e ao chacoalhar do veículo orbital, o comando para cancelar o lançamento soou com tanta clareza na mente da especialista da missão, Emma Watson, que ela achou tê-lo ouvido através da unidade de comunicação. Ninguém da tripulação dissera aquilo em voz alta, mas, naquele instante, ela sabia que teriam de se de­cidir, e com rapidez. Ainda não ouvira o veredicto do comandan­te Bob Kittredge ou da piloto Jill Hewitt, sentados à sua frente na cabine. Não era necessário. Trabalhavam em equipe havia tanto tempo que podiam ler a mente uns dos outros, e as luzes de ad­vertência cor de âmbar piscando no console de voo do ônibus espacial ditavam claramente as suas próximas ações.

Segundos antes, a Endeavouratingira Max Q, ponto de maior pressão aerodinâmica durante o lançamento, momento em que, lu­tando contra a resistência da atmosfera, o veículo orbital começava a vibrar violentamente. Kittredge já baixara a potência para 70 por cento para diminuir a vibração. Agora, as luzes de aviso do console diziam que haviam perdido dois de seus três motores principais. Mesmo com um motor principal e dois foguetes de combustível sólido ainda funcionando, jamais conseguiriam entrar em órbita.

Teriam de cancelar o lançamento.

—Controle, aqui é a Endeavour— disse Kittredge, com a voz inteiramente calma, sem sinal de apreensão. — Incapaz de acele­rar. Os ME[1] esquerdo e central pararam de funcionar em Max Q. Estamos sem alternativa. Procedendo a cancelamento RTLS.

—Entendido, Endeavour. Confirmamos dois ME ausentes. Proceder a cancelamento RTLS após exaustão dos SRB.

Emma folheou as listas de verificação e pegou o cartão para "Cancelamento com Retorno ao Local de Lançamento". A tripu­lação conhecia o procedimento de cor e salteado, mas, na pressa de um cancelamento de emergência, algum passo importante po­dia ser esquecido. A lista de procedimentos lhe dava segurança.

Com o coração disparado, Emma revisou a rotina adequada, destacada em azul. Sobreviver a um cancelamento RTLS com dois motores desligados era factível. Mas apenas em teoria. Uma sequência de pequenos milagres teria de ocorrer para tal. Primei­ro, teriam de jogar fora o combustível e desligar o último motor principal antes de se separarem do enorme tanque de combustí­vel externo. Então, Kittredge faria o veículo orbital rodar em seu eixo e voltaria a proa em direção ao local de lançamento. Ele teria uma chance — apenas uma — para levá-los a uma aterrissagem segura no Centro Espacial Kennedy. Um único erro, e a Endea­vour afundaria no oceano.

Suas vidas estavam agora nas mãos do capitão Kittredge.

Sua voz, em constante contato com o controle da missão, ainda soava tranquila, até mesmo um tanto entediada, ao se aproximarem da marca de dois minutos. Outro ponto crítico. O mo­nitor indicava "Pc<50". Os foguetes de combustível sólido esgo­tavam-se dentro do prazo previsto.

Emma sentiu imediatamente a tremenda desaceleração quando os foguetes consumiram os últimos resíduos de combustível. Então, um brilho intenso na janela a ofuscou quando os SRB se separaram do tanque externo.

O rugido do lançamento silenciou, a violenta trepidação cedendo lugar a um vagar suave, quase tranquilo. Em meio à súbita calmaria, sentiu o próprio pulso acelerar, seu coração batendo contra o peito constrito.

—Controle, aqui é a Endeavour— disse Kittredge, ainda incrivelmente calmo. — Separação de SRB concluída.

—Entendido, estamos vendo.

—Iniciando cancelamento. — Kittredge apertou o botão de cancelamento, um interruptor giratório já posicionado na opção RTLS.

Na sua unidade de comunicação, Emma ouviu Jill Hewitt dizer:

—Emma, quero ouvir a lista de procedimentos!

—Está bem aqui.

Emma começou a ler em voz alta, e sua voz era tão surpreendentemente calma quanto a de Kittredge e Hewitt. Qualquer um que ouvisse aquele diálogo jamais adivinharia que estavam a um passo da catástrofe. Passaram a trabalhar como máquinas, o pâ­nico suprimido, cada ação memorizada no treinamento. Os com­putadores de bordo automaticamente estabeleceriam a sua rota de volta para a base. Continuavam na trajetória, ainda a 121 qui­lômetros de altura, enquanto se livravam do combustível.

Então, ela sentiu uma leve vertigem quando o veículo orbital começou a manobra de retorno. O horizonte, que estava de cabe­ça para baixo, subitamente voltou ao lugar certo quando a proa apontou para o Centro Espacial Kennedy, a quase 650 quilôme­tros de distância.

—Endeavour, aqui é o controle. Desliguem o motor principal.

Entendido respondeu Kittredge. MECO agora.

No painel de instrumentos, os três indicadores de atividade dos motores começaram a piscar em vermelho. Ele desligara os três motores principais e, em vinte segundos, o tanque de combustível externo seria liberado sobre o mar.

A altitude está caindo rapidamente, pensou Emma. Mas estamos a caminho de casa.

Ela se assustou quando um alarme soou e novas luzes brilharam no console.

Controle, perdemos o computador número três! gritou Hewitt. Perdemos um vetor de navegação! Repetindo, perde­mos um vetor de navegação!

Pode ser um defeito de medição inercial disse Andy Mercer, o outro especialista da missão sentado ao lado de Emma. — Desligue-o.

Não! Pode ser falha em um barramento de dados! atalhou Emma. Sugiro acionar o reserva.

Concordo disse Kittredge.

Ligando o reserva disse Hewitt. E acionou o computa­dor número cinco.

O vetor reabriu. Todos deram um suspiro de alívio.

O ruído das cargas explosivas indicava a separação do tanque de combustível vazio. Não podiam vê-lo cair no mar, mas esse obstáculo havia sido vencido. O veículo orbital voava livre agora, um pássaro gordo e desajeitado planando de volta para casa.

Hewitt gritou:

Merda! Perdemos uma APU!

Emma ergueu a cabeça, sobressaltada, quando outro alarme soou. Então, soou mais um alarme, e seu olhar voltou-se em pâ­nico para os consoles. Diversas luzes âmbar piscavam. Todas as informações dos monitores se apagaram, substituídas por faixas pretas e brancas. Uma falha catastrófica de computador. Estavam voando sem navegador e sem controle de flaps.

Andy e eu estamos cuidando da APU! — gritou Emma.

—Religando o reserva! — Hewitt acionou o interruptor e soltou um palavrão. — Não estou gostando disso. Nada acontece...

—Tente de novo!

—Ainda nada.

—A nave está adernando! — gritou Emma, sentindo o estômago revirar.

Kittredge lutou com os controles, mas já estavam muito adernados para estibordo. O horizonte ficou na vertical e, a seguir, de cabeça para baixo. O estômago de Emma voltou a se revirar quando o lado direito da nave voltou-se para cima. A rotação seguinte veio mais rápida, o horizonte rodando em uma sequên­cia angustiante de mar e céu, mar e céu.

Uma espiral mortal.

Ela ouviu Hewitt gemer e ouviu Kittredge dizer, resignado:

—Nós a perdemos.

Então, o rodopiar fatal acelerou, a nave mergulhando em direção a um fim abrupto e chocante.

Silêncio.

Então, ouviram uma voz divertida nas unidades de comunicação:

—Perdão, pessoal. Desta vez não conseguiram.

Emma arrancou os fones de ouvido.

—Isso não valeu, Hazel!

Jill Hewitt acrescentou:

—Ei, você quis nos matar. Não havia como sair dessa.

Emma foi a primeira tripulante a sair do simulador de vôo. Com os outros logo atrás, foi até a sala de controle sem janelas onde seus três instrutores estavam sentados diante de uma fileira de consoles.

Com um sorriso malicioso nos lábios, a chefe da equipe, Hazel Barra, voltou-se para encarar os quatro irados tripulantes. Embora Hazel parecesse uma mãezona gorducha com gloriosos cabelos castanhos encaracolados, ela era, na verdade, uma jogadora impie­dosa, qu,e obrigava suas tripulações a passarem pelas simulações mais difíceis e parecia considerar-se vitoriosa toda vez que uma tripulação não conseguia sobreviver. Hazel sabia que todo lança­mento podia terminar em desastre e queria seus astronautas prepa­rados para sobreviver. Perder uma de suas equipes era um pesade­lo que ela esperava jamais ter de enfrentar,

- Esta simulação foi um golpe baixo, Hazel — reclamou Kittredge.

- Ei, vocês estão sempre escapando. Precisávamos baixar um pouco a sua crista.

—Ora vamos — disse Andy. — Dois motores falhando durante o lançamento? Uma pane em um barramento de dados? Uma APU ausente? Então, você acrescenta um computador nú­mero cinco com defeito? Aconteceram defeitos e falhas demais! Isso não foi realista.

Patrick, um dos outros instrutores, voltou-se para eles com um sorriso.

—Vocês sequer notaram as outras coisas que fizemos.

—O que mais?

- Inseri uma falha no sensor de seu tanque de oxigênio. Nenhum de vocês notou uma mudança no calibrador de pressão, não é mesmo?

Kittredge riu.

—E tivemos tempo para isso? Cuidávamos de outros dez defeitos ao mesmo tempo.

Hazel ergueu o braço gorducho, pedindo trégua.

—Tudo bem, pessoal. Talvez tenhamos exagerado. Francamente, ficamos surpresos quão longe foram no cancelamento RTLS. Decidimos inserir outros defeitos, para tornar as coisas mais interessantes.

—E usaram toda a sua caixa de ferramentas — desdenhou Hewitt.

—A verdade é que vocês estavam um tanto cheios de si — disse Patrick.

—A palavra é confiantes — atalhou Emma.

—O que é bom — admitiu Hazel. — É bom estar confiante. Vocês demonstraram grande trabalho de equipe na simulação in­tegrada na semana passada. Até mesmo Gordon Obie se disse im­pressionado.

—A Esfinge disse isso? — Kittredge ergueu uma sobrancelha, denotando surpresa.

Gordon Obie era o diretor de operações com tripulações de voo, um homem tão silencioso e reservado que ninguém no Cen­tro Espacial Johnson o conhecia de verdade. Podia assistir a reu­niões de administração de missões inteiras sem dizer uma única palavra, embora ninguém duvidasse que gravava mentalmente cada detalhe. Entre os astronautas, Obie era tanto admirado quanto um pouco temido. Com seu poder decisório sobre a escalação final dos vôos, ele podia criar ou destruir carreiras. O fato de ter elogiado a tripulação de Kittredge era um ótimo sinal.

Na frase seguinte, porém, Hazel os desmontou:

—Contudo, Obie também está preocupado com o fato de estarem muito relaxados. Isso ainda é um jogo para vocês.

—O que Obie espera que façamos? — perguntou Hewitt. — Que fiquemos obcecados com os 10 mil modos de cair e incendiar?

—O desastre não é teórico.

A frase de Hazel, dita de modo tão tranquilo, os fez ficar momentaneamente em silêncio. Desde a Challenger, cada membro do corpo de astronautas sabia que era apenas uma questão de tempo até acontecer outro grande desastre. Seres humanos que se senta­vam no topo de foguetes prontos para explodirem, com um empu­xo de quase 3 mil toneladas não podiam desprezar os riscos de sua profissão. Contudo, eles raramente falavam em morrer no espaço. Falar sobre isso seria admitir a possibilidade, reconhecer que a pró­xima Challenger podia incluir o seu nome na lista da tripulação.

Hazel deu-se conta de que baixara o moral do grupo. Não era uma boa maneira de terminar uma sessão de treinamento e, ago­ra, ela voltava atrás em suas críticas.

Só estou dizendo isso porque vocês já estão muito bem integrados. É difícil pegá-los. Vocês têm três meses até o lançamento e já estão em boa forma. Mas quero que fiquem ainda melhores.

Em outras palavras, pessoal disse Patrick de seu console —, menos empáfia.

Bob Kittredge baixou a cabeça fingindo humildade.

Iremos para casa para nos penitenciarmos.

A confiança excessiva é perigosa disse Hazel.

Ela se levantou da cadeira e encarou Kittredge.

Veterano de três voos no ônibus espacial, Kittredge era meia cabeça mais alto do que ela e tinha o jeito confiante de um piloto naval, o que, de fato, fora outrora. Hazel não se sentia intimidada por Kittredge ou por qualquer de seus astronautas. Fossem cientis­tas ou heróis militares, eles lhe inspiravam as mesmas preocupa­ções maternais, o desejo de que voltassem vivos de suas missões.

Você é um comandante tão bom, que faz a sua tripulação achar que isso é fácil.

Não, eles é que fazem isso parecer fácil. Porque são bons.

Veremos. As simulações integradas estão marcadas para terça-feira, com Hawley e Higuchi a bordo. Tiraremos mais al­guns truques da cartola.

Kittredge riu com amargura.

Tudo bem, tente nos matar. Mas jogue limpo.

O destino raramente joga limpo disse Hazel, solene. Não espere que eu jogue.

Emma e Bob Kittredge estavam sentados em um reservado no sa­lão do Fly By Night, bebendo cerveja enquanto dissecavam as simulações do dia. Era um ritual que tinham estabelecido havia 11 meses, na época da formação da equipe, quando os quatro se jun­taram pela primeira vez como a tripulação do vôo 162 do ônibus espacial. Toda noite de sexta-feira, encontravam-se no Fly By Night, localizado na Estrada 1 do Centro Espacial Johnson, da NASA, para revisar o progresso de seu treinamento. O que fizeram direito, o que ainda precisavam melhorar. Kittredge, que selecio­nara pessoalmente cada membro de sua tripulação, começara o ritual. Embora trabalhassem juntos mais de sessenta horas por se­mana, ele nunca parecia ansioso para ir embora. De início, Emma achou que aquilo se devia ao fato de ele ter recentemente se divorciado. Kittredge agora morava sozinho e não gostava de voltar para a casa vazia. Mas quando começou a conhecê-lo melhor, ela perce­beu que tais reuniões eram simplesmente o seu modo de prolongar a adrenalina do trabalho. Kittredge vivia para voar. Lia os áridos manuais do ônibus espacial por pura diversão. Passava todo o tem­po livre que tinha pilotando um dos T-38 da NASA. Parecia res­sentir-se da força da gravidade que prendia seus pés à terra.

Ele não conseguia entender por que o resto de sua tripulação gostava de ir para casa ao fim do dia e, naquela noite, parecia um tanto triste pelo fato de apenas eles dois estarem sentados na mesa de sempre no Fly By Night. Jill Hewitt estava em um recital de piano do sobrinho e Andy Mercer estava em casa celebrando o décimo aniversário de casamento. Apenas Emma e Kittredge compareceram à hora combinada, e agora que terminavam de esmiuçar as simulações da semana, pairou um longo silêncio en­tre os dois. Deixaram de falar sobre assuntos de trabalho e, por­tanto, a conversa perdeu o fôlego.

—Vou levar um dos T-38 até White Sands amanhã — disse ele. — Quer vir comigo?

—Não posso. Tenho um compromisso com meu advogado.

—Então você e Jack vão levar isso adiante?

Ela suspirou.

—Estamos levando. Jack tem o advogado dele, eu tenho o meu. Este divórcio está fora do nosso controle.

—Parece-me que você não está muito segura.

Ela baixou a cerveja com firmeza.

—Claro que estou.

—Então, por que ainda está usando sua aliança de casamento?

Ela olhou para o dedo. Subitamente enfurecida, tentou arrancar a aliança, mas não conseguiu. Após sete anos no dedo de Emma, aquilo parecia amoldado à sua carne, recusando-se a ser retirado. Ela amaldiçoou e puxou outra vez, desta vez com tanta força que arrancou um pedaço de pele ao passar a aliança pelo nó do dedo. Depois, colocou-a sobre a mesa.

—Pronto. Uma mulher livre.

Kittredge riu.

—Vocês dois estão arrastado esse divórcio há mais tempo do que eu fui casado. Afinal, sobre o que discutem tanto?

Ela afundou na cadeira, subitamente cansada.

—Sobre tudo. Admito que também não tenho sido razoável. Há algumas semanas, tentamos nos sentar e fazer uma lista de todos os nossos bens. O que eu queria, o que ele queria. Prome­temos ser civilizados a este respeito. Dois adultos calmos e madu­ros. Bem, quando chegamos à metade da lista, já estávamos em pé de guerra, sem fazer prisioneiros. — Emma suspirou.

Na verdade, ela e Jack sempre haviam sido assim. Igualmente obstinados, ferozmente apaixonados. Fosse na paz ou na guerra, havia sempre fagulhas entre os dois.

—Só concordamos com uma coisa — disse ela. — Consegui ficar com o gato.

—Sorte sua.

Ela olhou para ele.

—Você alguma vez se arrependeu?

—Refere-se ao meu divórcio? Nunca.

Embora a resposta tivesse sido inequívoca e fria, seu olhar baixou como se estivesse tentando ocultar uma verdade que ambos sabiam: que ele ainda se ressentia da falência de seu casamento.

Até mesmo um homem com coragem bastante para se amarrar em cima de milhões de quilos de combustível explosivo podia sofrer de solidão.

—Este é o problema. Finalmente descobri — disse ele. — Os civis não nos compreendem porque não compartilham do sonho. As únicas mulheres que continuam casadas com astronautas ou são santas ou são mártires. Ou aquelas que não dão a mínima se estamos vivos ou mortos. — Ele riu com amargura. — Bonnie não era uma mártir. E certamente não compreendia o sonho.

Emma olhou para sua aliança brilhando sobre a mesa.

Jack compreende — murmurou. — Também era o sonho dele. Foi isso que estragou tudo. O fato de eu ir para o espaço e ele não poder fazer o mesmo. O fato dele ter sido deixado para trás.

—Então ele precisa crescer e enfrentar a realidade. Nem todo mundo foi feito para isso.

— Sabe, realmente gostaria que não se referisse a ele como algum tipo de rejeitado.

—Ei, foi ele quem se demitiu.

—E o que mais poderia fazer? Ele sabia que não seria escala­do para nenhum voo. Se não o deixariam voar, não havia por que fazer parte do grupo.

—Eles o mantiveram em terra para o seu próprio bem.

—Foi um palpite médico. O fato de ter tido uma pedra no rim não quer dizer que vá ter outra.

—Tudo bem, Dra. Watson. Você é a médica. Diga-me, você aceitaria Jack em nossa tripulação? Sabendo do problema clínico dele?

Ela fez uma pausa.

—Sim. Como médica, sim, aceitaria. Provavelmente Jack se sairia muito bem no espaço. Ele tem tanto a oferecer que não imagino por que não o querem lá em cima. Posso estar me divor­ciando dele, mas eu o respeito.

Kittredge riu e esvaziou a caneca de cerveja.

—Você não é muito imparcial nesse assunto, não é mesmo?

Ela fez menção de responder, mas logo se deu conta de que não tinha defesa. Kittredge estava certo. No que dizia respeito a Jack McCallum, ela jamais fora imparcial.

Lá fora, em meio ao calor úmido de uma noite de verão em Houston, ela parou no estacionamento do Fly By Night e olhou para o céu. O brilho das luzes da cidade ofuscava as estrelas, mas ela ainda podia distinguir constelações reconfortantemente fami­liares. Cassiopeia, Andrômeda e as Plêiades. Toda vez que olhava para elas, lembrava-se do que Jack lhe dissera quando estavam deitados na grama certa noite de verão, olhando para as estrelas. Na noite em que pela primeira vez se dera conta de que estava apaixonada por ele. O céu está cheio de mulheres, Emma. Você de­via estar lá.

Ela murmurou:

—Você também, Jack.

Ela abriu a porta do carro e sentou-se no banco do motorista. Enfiando a mão no bolso, pegou a aliança. Olhando para ela na penumbra do carro, pensou nos sete anos de casamento que re­presentava. Perto do fim, agora.

Ela voltou a guardar a aliança no bolso. Sentia a mão esquer­da nua, exposta. Terei de me acostumar com isso, pensou, antes de girar a chave na ignição.

 

10 de julho

O Dr. Jack McCallum ouviu a sirene da primeira ambulância e disse:

Hora do show, pessoal!

Saindo à área de desembarque da emergência do hospital, sentiu o pulso acelerar e a adrenalina transformar o seu sistema nervoso em fios carregados de eletricidade. Ele não fazia idéia do que viria para o Miles Memorial Hospital, apenas que havia mais de um paciente a caminho. Pelo rádio, souberam que um engavetamento de 15 carros na I-45 matara duas pessoas no local e dei­xara diversos feridos. Embora os pacientes mais gravemente feri­dos tivessem sido levados ao Bayshore ou ao Texas Med, todos os pequenos hospitais da região, incluindo o Miles Memorial, se prepararam para receber a sobrecarga.

Jack olhou ao redor na garagem das ambulâncias para confirmar se a sua equipe estava pronta. A outra médica na emergência, Anna Slezak, estava bem ao seu lado e parecia pronta para o que desse e viesse. Sua equipe de apoio incluía quatro enfermeiras, um laboratorista e um interno assustado. Com apenas um mês de formado, o interno era o membro mais inexperiente da equipe da emergência e era um desastrado incorrigível. Perfeito para o ramo da psiquiatria, pensou Jack.

A sirene foi desligada quando a ambulância subiu a rampa e entrou de ré na garagem. Jack abriu a porta traseira e viu o paciente pela primeira vez. Era uma jovem, cabeça e pescoço imo­bilizados em um colar cervical, o cabelo louro sujo de sangue. Quando a tiraram da ambulância e ele a viu mais de perto, Jack sentiu um arrepio ao reconhecê-la.

Debbie.

Ela olhou para ele, os olhos embaçados, e pareceu não saber quem era.

—É Jack McCallum.

Oh. Jack. — Ela fechou os olhos e gemeu. — Minha cabe­ça dói.

Ele a reconfortou com um afago no ombro.

—Cuidaremos bem de você, querida. Não se preocupe.

Debbie foi levada na maca em direção à sala de traumas.

—Você a conhece? — perguntou Anna.

—O marido dela é Bill Haning. O astronauta.

—Refere-se a um dos sujeitos que está na estação espacial? — Anna riu. — Isso é o que chamo de uma ligação de longa distância!

—Não será problema encontrá-lo caso seja necessário. O Centro Espacial Johnson pode avisá-lo imediatamente.

—Quer que eu cuide desta paciente?

Era uma pergunta razoável. Os médicos geralmente evitam cuidar de amigos ou familiares. Não se pode manter a objetivida­de quando o paciente enfartado sobre a mesa é alguém que você conhece e gosta. Embora ele e Debbie tivessem certa vez feito par­te do mesmo círculo social, Jack a considerava apenas uma co­nhecida, não um amiga, e sentia-se à vontade sendo seu médico.

—Deixe comigo — disse ele, e seguiu a maca até a sala de trauma.

Sua mente já antecipava o que deveria ser feito. O único ferimento visível era uma laceração no couro cabeludo, mas, uma vez que ela evidentemente sofrera uma pancada na cabeça, Jack não poderia afastar a hipótese de fratura no crânio ou na coluna cervical.

Enquanto as enfermeiras tiravam sangue para exame e delicadamente retiravam o restante das roupas de Debbie, o atendente da ambulância deu-lhe um rápido histórico da situação.

—Ela era o quinto carro no engavetamento. Ao que eu saiba, foi atingida por trás, o carro ficou atravessado na pista e acabou levando outra trombada, desta vez no lado do motorista. A porta estava afundada.

—Ela estava consciente?

—Ficou inconsciente alguns minutos. Acordou quando estávamos introduzindo uma endovenosa. Imobilizamos a coluna dela imediatamente. A pressão sanguínea e o ritmo cardíaco es­tão estáveis. Ela foi uma das que teve sorte. — O atendente balan­çou a cabeça. — Devia ter visto o cara atrás dela.

Jack foi até a maca examinar a paciente. Ambas as pupilas de Debbie reagiam à luz, e seus movimentos extraoculares estavam normais. Ela conseguia dizer o próprio nome e onde estava, mas não se lembrava da data. Leve desorientação espaçotemporal, pensou ele. Era razão suficiente para admiti-la, mesmo que fosse para ficar em observação por uma noite.

— Debbie, vou mandar tirar algumas radiografias — disse ele. — Precisamos nos certificar de que não quebrou nada. — Ele olhou para a enfermeira. — Tomografia computadorizada do crânio e coluna cervical. E... — Ele fez uma pausa, ouvindo.

Outra sirene de ambulância se aproximando.

—Faça essas chapas — ordenou.

Em seguida, voltou à área de carga onde a equipe voltara a se reunir.

Uma segunda sirene, mais fraca, somou-se à primeira. Jack e Anna se entreolharam, alarmados. Duas ambulâncias a caminho?

—Vai ser um dia daqueles — murmurou ele.

—A sala de trauma está vazia? — perguntou Anna.

—A paciente foi levada à radiografia.

Ele avançou um passo quando a primeira ambulância deu a ré. No momento em que o veículo parou, ele abriu a porta.

Desta vez era um homem de meia-idade e acima do peso, pele pálida e suada. Está entrando em choque, foi o que Jack pensou de início, mas não viu sangue nem sinais de ferimento.

—Ele foi um dos engavetados — disse o técnico da emergência enquanto levavam o paciente à sala de tratamento. — Sentiu dor no peito quando o tiramos do carro. O ritmo está estável, um pouco de taquicardia, mas sem contração ventricular prematura. Pressão sistólica em 90. Demos morfina e nitro no local, e o oxi­gênio já chega a 6 litros.

Todos estavam em atividade. Enquanto Anna anotava o histórico e o estado físico do paciente, as enfermeiras aplicavam os sensores cardíacos. O resultado do ECG saiu da máquina. Jack arrancou a folha e imediatamente concentrou-se nas elevações de taquicardia sinus nos marcadores V1 e V2.

— Infarto do miocárdio em parede anterior — disse ele para Anna.

Ela assentiu.

—Achei mesmo que ele era um caso de tPA.

Uma enfermeira veio à porta e anunciou:

—A outra ambulância chegou!

Jack e duas enfermeiras correram para fora.

Uma jovem gritava e se contorcia na maca.

Jack olhou uma única vez para a perna direita mais curta, o pé quase completamente torcido, e viu que aquela paciente iria direto para a cirurgia. Ele rapidamente rasgou as roupas dela para revelar uma fratura de quadril por impacto, a cabeça do fêmur encravada na junção com a bacia pelo impacto dos joelhos contra o painel do carro. Sentia náuseas só de olhar para a perna grossei­ramente deformada.

—Morfina? — perguntou a enfermeira.

Ele assentiu.

—Dê o quanto precisar. Ela está com muita dor. Faça um teste de tipo de sangue e separe seis unidades. E consiga um ortopedista o mais rápido que...

—Dr. McCallum, compareça imediatamente à radiologia. Dr. McCallum, compareça imediatamente à radiologia.

Jack ergueu a cabeça, alarmado. Debbie Haning, pensou. E saiu correndo da sala.

Encontrou Debbie deitada na mesa de raios X, cercada pela enfermeira e do técnico da emergência.

—Acabamos de fazer as chapas da coluna e do crânio — dis­se o técnico. — Mas não conseguimos acordá-la. Ela sequer responde à dor.

—Há quanto tempo está desacordada?

—Não sei. Ficou deitada na mesa uns 10, 15 minutos antes de percebermos que não estava mais conversando.

—Fizeram a tomografia computadorizada?

—O computador está com defeito. Deve voltar a funcionar em algumas horas.

Jack iluminou os olhos de Debbie com uma lanterna e sentiu o estômago revirar. A pupila esquerda dela estava dilatada e não reagia à luz.

—Mostre-me as chapas — disse ele.

—A da coluna cervical já está na caixa de luz.

Jack foi rapidamente até a sala ao lado e olhou para as radiografias na caixa de luz. Não viu fraturas nas chapas do pescoço. A coluna cervical estava estável. Tirou as chapas do pescoço da cai­xa de luz e as substituiu pelas do crânio. À primeira vista, nada viu que fosse imediatamente óbvio. Então, seu olhar se concen­trou em uma linha quase imperceptível atravessando o osso tem­poral esquerdo. Era tão sutil que parecia um arranhão no filme. Uma fratura.

Teria a fratura rompido a artéria meníngea média esquerda? Aquilo causaria hemorragia no interior do crânio. À medida que o sangue se acumulasse e a pressão aumentasse, o cérebro seria esmagado. Aquilo explicava a rápida deterioração de sua situação mental e as pupilas dilatadas.

O sangue tinha de ser drenado imediatamente.

—Levem-na de volta à emergência! — disse ele.

Em alguns segundos, Debbie foi atada à maca e a levaram pelo corredor. Quando entraram em uma sala de tratamento va­zia, ele gritou para o assistente.

—Entre em contato com a neurocirurgia imediatamente! Diga-lhes que temos uma hemorragia epidural e estamos prepa­rando uma trepanação de emergência. — Ele sabia que o que Debbie realmente precisava era da sala de cirurgia, mas sua situ­ação se complicava tão rapidamente que ele não tinha tempo para esperar. A sala de tratamento teria de servir. Eles a deitaram em uma mesa e conectaram um emaranhado de sensores de ECG em seu peito. Sua respiração ficou irregular. Era hora de ser entubada.

Ele havia acabado de abrir o pacote que continha o tubo endotraqueal quando uma enfermeira disse:

—Ela parou de respirar! — Jack introduziu o laringoscópio na garganta de Debbie. Segundos depois, o tubo endotraqueal estava no lugar e o oxigênio era bombeado em seus pulmões.

Uma enfermeira ligou o barbeador elétrico. O cabelo louro de Debbie começou a cair no chão em tufos sedosos, expondo o couro cabeludo.

O auxiliar enfiou a cabeça pela fresta da porta.

—O neurocirurgião está preso no trânsito! Não chegará aqui em menos de uma hora.

—Então chame outra pessoa!

—Estão todos no Texas Med! Estão recebendo todo mundo com ferimentos na cabeça.

Deus, estamos ferrados, pensou Jack, olhando para Debbie.

A cada minuto que passava, a pressão dentro do crânio dela aumentava. As células nervosas estavam morrendo. Se fosse mi­nha mulher, eu não esperaria. Nem mais um segundo.

Ele engoliu em seco.

—Tragam a broca de Hudson. Eu mesmo farei a trepanação. — Viu a expressão assustada das enfermeiras e acrescentou, mais confiante do que de fato se sentia: — E como fazer buracos em uma parede. Já fiz isso antes.

Enquanto as enfermeiras preparavam o couro cabeludo recém-raspado, Jack colocava o gorro e as luvas cirúrgicas. Posicio­nou os campos cirúrgicos estéreis e surpreendeu-se ao ver que suas mãos ainda estavam firmes, mesmo com o coração dispara­do. Era verdade que já fizera trepanações, mas apenas uma vez, havia anos, sob a supervisão de um neurocirurgião.

Não há mais tempo. Ela está morrendo. Faça.

Pegou o bisturi e fez uma incisão linear no couro cabeludo, sobre o osso temporal esquerdo. O sangue fluiu. Ele o limpou e cauterizou o ferimento. Usando um retrator para afastar a aba de pele, cortou profundamente através da gálea e atingiu o pericrânio, que afastou, expondo a superfície do crânio.

Pegou a broca de Hudson. Era um instrumento mecânico, movido à mão e com um aspecto quase arcaico, o tipo de ferra­menta que encontramos na oficina de nossos avós. Primeiro, usou o perfurador, uma broca em forma de pá com o qual perfu­rou o osso apenas o bastante para fazer um buraco. Então, mu­dou para a broca de ponta arredondada, com bordas múltiplas. Inspirou, posicionou a broca e começou a furar mais profunda­mente. Em direção ao cérebro. Em sua testa, apareceram as pri­meiras gotículas de suor. Ele trabalhava sem confirmação da to­mografia, baseando-se exclusivamente em seu discernimento clínico. Ele sequer sabia se estava abrindo no lugar certo.

Uma súbita golfada de sangue saiu pelo buraco e salpicou os campos cirúrgicos.

Uma enfermeira entregou-lhe uma bacia. Ele retirou a broca e observou o fluxo regular de sangue que saía do crânio e se acu­mulava em uma poça brilhante na bacia. Ele furara no lugar cer­to. A cada gota de sangue, a pressão diminuía no cérebro de Debbie Haning.

Ele inspirou profundamente e a tensão subitamente cedeu em seus ombros, deixando seus músculos exaustos e doloridos.

—Prepare a cera para ossos — disse ele.

Então, baixou a broca e pegou o cateter de sucção.

Um rato branco vagava em pleno ar, como se suspenso em um mar transparente. A Dra. Emma Watson flutuou em direção ao animal, membros esguios e graciosos como uma dançarina suba­quática, os cachos encaracolados de seu cabelo castanho-escuro abertos em uma auréola fantasmagórica. Ela agarrou o rato e len­tamente o pôs na câmara. Então, ergueu uma seringa com uma agulha.

O filme tinha mais de dois anos e fora filmado a bordo do ônibus espacial Atlantis durante a STS 141. Mas era o filme de relações públicas favorito de Gordon Obie, motivo pelo qual es­tava passando agora em todos os monitores do Auditório Teague da NASA. Quem não gostava de ver Emma Watson? Era rápida, ágil e possuía algo que só podia ser chamado de brilho, o fogo da curiosidade nos olhos. Da pequena cicatriz sobre a sobrancelha ao dente da frente ligeiramente trincado (lembrança, ele ouvira dizer, de prática imprudente de esqui) seu rosto tinha as marcas de uma vida exuberante. Mas, para Gordon, seu forte era a inte­ligência. Sua competência. Ele seguia a carreira de Emma na NASA com um interesse que nada tinha a ver com o fato dela ser uma mulher atraente.

Como diretor de Operações de Tripulação, Gordon Obie ti­nha considerável poder sobre a seleção das tripulações e lutava para manter uma distância emocional segura — alguns chama­riam de impiedosa — de seus astronautas. Ele mesmo fora um astronauta, duas vezes como comandante de um ônibus espacial, e mesmo então já era conhecido como Esfinge, um homem reser­vado e misterioso que não era dado a conversa fiada. Sentia-se confortável com o próprio silêncio e relativo anonimato. Embora agora estivesse sentado no palco com um grupo de autoridades da NASA, a maioria das pessoas na platéia não sabia quem era Gordon Obie. Ele estava ali apenas para efeito decorativo, do mesmo modo que estava o filme de Emma Watson, um rosto atraente para manter o interesse da platéia.

O vídeo terminou, substituído na tela pelo logotipo da NASA, carinhosamente chamado de almôndega, um círculo azul repleto de estrelas, embelezado por uma elipse orbital e uma linha trans­versal vermelha bifurcada. O administrador da NASA, Leroy Cornell, e o diretor do Centro Espacial Johnson, Ken Blankenship, subiram ao púlpito para responder perguntas. Sua missão, na verdade, era esmolar dinheiro, por isso enfrentavam uma platéia de deputados e senadores céticos, membros de vários subcomitês que determinavam o orçamento da NASA. Pelo segundo ano se­guido, a NASA sofrera cortes devastadores e, ultimamente, uma atmosfera de abjeta melancolia reinava nos corredores do Centro Espacial Johnson.

Olhando para aquela plateia de homens e mulheres bem-vestidos, Gordon sentiu como se estivesse diante de uma cultura estra­nha. O que havia de errado com aqueles políticos? Como podiam ser tão míopes? Ficava perplexo pelo fato de não compartilharem sua crença mais profunda. O que distingue a humanidade dos ou­tros animais é a fome de conhecimento. Toda criança faz a pergun­ta universal: Por quê? São programadas desde o nascimento para serem curiosas, exploradoras, para buscarem verdades científicas.

No entanto, aqueles políticos eleitos haviam perdido a curiosidade que torna o homem um animal único. Eles vieram a Hous­ton não para perguntar por que, mas, sim pelo por que devemos fazê-lo?

Foi idéia de Cornell adulá-los com aquilo que chamou cinicamente de "O tour de Tom Hanks", uma referência ao filme Apollo 13, que ainda era uma das melhores campanhas de rela­ções públicas que a NASA já teve. Cornell já apresentara as últi­mas conquistas a bordo da ISS. Ele os deixara cumprimentar as­tronautas de verdade. Não é isso o que todo mundo quer? Tocar em um rapaz dourado, um herói? A seguir, fizeram um tour pelo Centro Espacial Johnson, começando com o Prédio 30 e a Sala de Controle de Vôo. Não importava o fato daquela platéia não saber a diferença entre um console de voo e um Nintendo. Toda aque­la alta tecnologia certamente os encantaria e os tornaria verdadei­ros fiéis.

Mas não estava funcionando, pensou Gordon, desiludido. Esses políticos não estão comprando o meu peixe.

A NASA enfrentava poderosa oposição, a começar pelo senador Phil Parish, um inflexível parlamentar da Carolina do Sul de 76 anos, sentado na primeira fila. Parish tinha como prioridade pre­servar o orçamento da defesa. A NASA que se danasse.

—Sua agência estourou o orçamento daquela estação espacial em bilhões de dólares — disse ele, após erguer da poltrona seus 150 quilos de peso. — Não creio que o povo americano deseje sacrificar sua capacidade de defesa para que vocês possam brincar no seu sofisticado laboratório de experiências. Isso era para ser um esfor­ço internacional, não é mesmo? Bem, ao que me consta, estamos pagando a maior parte da conta. Como poderei justificar este ele­fante branco para a boa gente da Carolina do Sul?

O administrador da NASA, Cornell, respondeu com um sorriso preparado para a câmera. Ele era um animal político, um diplomata cujo encanto e carisma o tornavam uma estrela junto à imprensa de Washington, onde ele passava a maior parte do tempo bajulando o Congresso e a Casa Branca em busca de mais dinheiro, sempre mais dinheiro, para completar o orçamento per­manentemente insuficiente da agência. Ele era a face conhecida da NASA, enquanto Ken Blankenship, encarregado das ações do dia a dia no Centro Espacial Johnson, era a face oculta, conhecido apenas pelo pessoal da agência. Eles eram o yin e o yang da lide­rança da NASA, tão diferentes em temperamento que era difícil imaginar como conseguiam trabalhar em equipe. Uma das pia­das internas da NASA dizia que Leroy Cornell era todo estilo e nenhuma substância, e Blankenship era pura substância e ne­nhum estilo.

Cornell respondeu calmamente à pergunta do senador Parish.

—Você me perguntou por que outros países não estão contribuindo. Senador, a resposta é que já contribuíram. Esta é, de fato, uma estação internacional. Sim, os russos estão sem dinhei­ro. Sim, tivemos de arcar com a diferença. Mas estão comprome­tidos com a estação. Eles têm um cosmonauta lá em cima neste momento e têm todo o interesse em nos ajudar a manter a estação funcionando. Quanto ao por que precisamos da estação, apenas veja a pesquisa que vem sendo conduzida em biologia, medicina, ciência dos materiais. Geofísica. Veremos os benefícios destas pesquisas em nossa vida.

Outro membro da plateia se levantou, e Gordon sentiu sua pressão aumentar. Se havia alguém que ele desprezasse mais que o senador Parish, era o deputado de Montana, Joe Bellingham, cuja boa aparência de "Homem de Marlboro" não escondia o fato dele ser uma besta em ciência. Durante a sua última campa­nha, ele exigiu que as escolas públicas ensinassem Criacionismo. Joguem fora os livros de biologia e abram a Bíblia. Ele provavel­mente devia acreditar que os foguetes são impulsionados por anjos.

—E aquela conversa de compartilhar tecnologia com russos e japoneses? — perguntou Bellingham. — Eu me pergunto se es­tamos entregando segredos de alta tecnologia a troco de nada. Esta cooperação internacional parece algo muito elevado e tudo o mais, mas o que os impede de passarem a usar tal conhecimen­to contra nós? Por que devemos confiar nos russos?

Medo e paranóia. Ignorância e superstição. Havia muito dis­so no país. Gordon ficava deprimido só de ouvir Bellingham falar e desviou o olhar, enfastiado.

Foi quando percebeu que Hank Millar entrou no auditório com uma expressão grave. Millar era o chefe do Bureau dos As­tronautas. Olhou diretamente para Gordon, que compreendeu imediatamente que havia algum problema.

Silenciosamente, Gordon saiu do palco e os dois foram até o corredor.

—O que houve?

—Aconteceu um acidente com a mulher de Bill Haning. Parece que é grave.

—Meu Deus.

—Bob Kittredge e Woody Ellis estão esperando no escritório de Relações Públicas. Todos precisamos conversar.

Gordon assentiu. Ele olhou através da porta do auditório para o deputado Bellingham, que ainda dizia asneiras sobre os perigos de se compartilhar tecnologia com os comunistas. Com a expressão severa, seguiu Hank até a saída do auditório. Ambos atravessaram o pátio e foram até o prédio ao lado.

Reuniram-se em um escritório dos fundos. Kittredge, comandante do ônibus espacial na STS 162, estava vermelho e agi­tado. Woody Ellis, diretor de voo da ISS, parecia bem mais cal­mo, mas, afinal, Gordon jamais vira Ellis preocupado, mesmo no meio de uma crise.

—Quão grave foi o acidente? — perguntou Gordon.

—O carro da Sra. Haning foi atingido em um engavetamento gigante na I-45 — disse Hank. — A ambulância a levou ao Miles Memorial. Jack McCallum a atendeu na emergência.

Gordon meneou a cabeça. Todos conheciam Jack. Embora não fizesse mais parte do plantel de astronautas, Jack ainda fazia parte do grupo ativo de cirurgiões de voo da NASA. Havia um ano, renunciara à maioria de suas obrigações com a agência para trabalhar como médico de emergência no setor privado.

—Foi Jack quem ligou para o nosso escritório para falar so­bre Debbie — disse Hank.

—Ele disse alguma coisa sobre as condições dela?

—Ferimento sério na cabeça. Está na UTI, em coma.

—Prognóstico?

—Ele não conseguiu responder a esta pergunta.

Houve um silêncio quando todos consideraram o que tal tragédia significava para a NASA. Hank suspirou.

—Teremos de contar para o Bill. Não podemos esconder isso dele. O problema é... — Ele não terminou. Mas não foi preciso. Todos conheciam o problema.

Bill Haning estava em órbita, a bordo da ISS, no primeiro mês de uma estadia de quatro meses. Tal notícia acabaria com ele. De todos os fatores que dificultavam as estadias prolongadas no espa­ço, era com o custo emocional que a NASA mais se preocupava. Um astronauta deprimido poderia acabar com uma missão. Ha­via alguns anos, na Mir,acontecera um incidente semelhante quando o cosmonauta Volodya Dejurov foi informado da morte da mãe. Ele se fechara em um dos módulos da Mire se recusara a falar com o Controle da Missão em Moscou por dias a fio. Seu pesar atrapalhara o trabalho de todo mundo a bordo da estação.

—Eles têm um casamento muito feliz — disse Hank. — Pos­so garantir que Bill não vai levar isso na boa.

—Está recomendando que seja substituído? — perguntou Gordon.

—No próximo voo do ônibus espacial. Vai passar momentos bem difíceis preso lá em cima nos próximos 15 dias. Não pode­mos pedir que cumpra os quatro meses.

Hank fez uma pausa e acrescentou em voz baixa:

—Eles têm dois filhos pequenos, você sabe.

—Seu substituto na ISS é Emma Watson — disse Woody Ellis. — Podemos mandá-la no STS 160, com a tripulação de Vance.

Ao mencionar o nome de Emma, Gordon teve o cuidado de não revelar qualquer sinal de interesse especial. Nenhum tipo de emoção.

—O que acha de Watson? Ela está pronta para subir três meses antes?

—Ela está agendada para substituir Bill. Ela já está em dia com a maioria das experiências a serem realizadas a bordo. Portanto, acho a opção viável.

—Bem, não gosto disso — afirmou Bob Kittredge.

Gordon deu um suspiro entediado e voltou-se para o comandante do ônibus espacial.

—Não achei que fosse gostar.

Watson é parte essencial da minha tripulação. Formamos uma equipe. Detesto ter de me desfazer dela.

—Sua equipe está a três meses do lançamento. Terá tempo de fazer os ajustes devidos.

—Você está dificultando o meu trabalho.

—Está me dizendo que não consegue formar uma nova equipe nesse tempo?

Kittredge apertou os lábios.

—Tudo o que estou dizendo é que minha tripulação já é uma unidade integrada. Não vamos gostar da ideia de perder Watson.

Gordon olhou para Hank.

—E quanto à tripulação do STS 160? Vance e sua equipe?

—Nenhum problema com eles. Watson seria apenas outro passageiro. Eles a entregarão na ISS como mais uma carga.

Gordon pensou a respeito. Ainda estavam falando de opções, não de certezas. Talvez Debbie Haning despertasse bem e Bill pu­desse ficar na ISS como programado. Mas assim como todo mun­do na NASA, Gordon aprendera a se preparar para todas as con­tingências, a carregar em sua cabeça um fluxograma mental de quais ações deveriam ser tomadas caso a, b ou c acontecesse.

Ele olhou para Woody Ellis para ter a confirmação. Woody assentiu.

—Tudo bem — disse Gordon. — Encontre Emma Watson para mim.

Ela o viu na outra extremidade do corredor do hospital. Conver­sava com Hank Millar e, embora estivesse de costas para ela e usando luvas cirúrgicas padrão na cor verde, Emma sabia que era Jack. Sete anos de casamento haviam deixado laços de familiari­dade que iam além do simples reconhecimento de seu rosto.

Esta era, na verdade, a mesma cena em que vira Jack McCallum na primeira vez em que se encontraram, quando am­bos eram residentes na emergência do Hospital Geral de São Francisco. Ele estava de pé no posto das enfermeiras escrevendo em uma planilha, ombros largos inclinados de fadiga, cabelo des­penteado como se tivesse acabado de sair da cama. De fato, aca­bara de sair. Aquela fora a manhã seguinte de uma noite muito agitada no plantão e, embora não tivesse feito a barba e estivesse exausto, quando se virou, olhando para ela pela primeira vez, a atração entre os dois foi instantânea.

Agora, Jack estava dez anos mais velho, seu cabelo outrora escuro tinha mechas grisalhas e a fadiga outra vez pesava sobre seus ombros. Ela não o via havia três semanas; falara brevemente com ele ao telefone alguns dias antes, numa conversa que des­cambara em outra barulhenta discussão. Ultimamente, não con­seguiam ser razoáveis um com o outro, não conseguiam entabu­lar uma conversa civilizada, mesmo que breve.

Portanto, foi com apreensão que ela continuou a descer o corredor em sua direção.

Hank Millar a viu primeiro e seu rosto ficou instantaneamente tenso, como se soubesse da batalha iminente e quisesse dar o fora dali antes de um tiroteio começar. Jack também deve ter no­tado a mudança de expressão de Hank, porque se voltou para ver o que a provocara.

Ao ver Emma, ele pareceu ter ficado paralisado, um espontâneo sorriso de cumprimento formando-se em seus lábios. Foi quase, mas não exatamente, um olhar tanto de surpresa quanto de felicidade por vê-la. Então, algo mais assumiu o controle e o sorriso desapareceu, substituído por um olhar nem amistoso nem hostil. Simplesmente neutro. O rosto de um estranho, pen­sou ela, e isso de algum modo era mais doloroso do que se Jack a tivesse tratado com explícita hostilidade. Neste caso, ao menos haveria alguma emoção, algum resíduo de um casamento que outrora fora feliz.

Ela se descobriu respondendo à sua expressão com uma expressão igualmente neutra. Ao falar, dirigiu-se aos dois ao mes­mo tempo, sem favorecer nenhum deles.

Gordon me contou sobre Debbie — disse ela. — Como ela está?

Hank olhou para Jack, esperando que ele respondesse. Afinal, Hank disse:

—Ela ainda está inconsciente. Estamos fazendo uma espécie de vigília na sala de espera. Se quiser, pode se juntar a nós.

—Sim, claro.

Ela fez menção de se dirigir à sala de espera.

Emma — chamou Jack. — Podemos conversar?

—Vejo vocês depois — disse Hank, antes de se retirar rapidamente corredor abaixo. Esperaram que ele fosse embora e, en­tão, olharam um para o outro.

—Debbie não está bem — disse Jack.

—O que houve?

—Ela teve uma hemorragia epidural. Chegou consciente e falando. Em alguns minutos, foi tudo por água abaixo. Eu estava ocupado com outro paciente. Não me dei conta na hora. Não abri o crânio dela até... — Ele fez uma pausa e desviou o olhar. — Ela está no ventilador.

Emma fez menção de tocá-lo, então se deteve, sabendo que ele a rejeitaria. Demoraria muito até Jack voltar a aceitar as suas palavras de conforto. Não importando o que ela dissesse, ou quão sinceramente ela se expressasse, ele encararia aquilo como pieda­de, o que desprezava.

—É um diagnóstico difícil, Jack. — Foi tudo o que ela conseguiu dizer.

—Eu devia ter percebido antes.

—Você disse que o estado dela piorou rapidamente. Não fi­que especulando.

—Isso não me faz sentir muito melhor.

—Não estou tentando fazer com que se sinta melhor! — dis­se ela, exasperada. — Só estou lembrando que você fez o diagnós­tico correto. E que agiu. Uma vez na vida você não poderia se dar um desconto?

—Veja, isso não diz respeito a mim, está bem? — rebateu Jack. — Tem a ver com você.

—Como assim?

Debbie não vai receber alta do hospital tão cedo. Isso significa que Bill...

—Eu sei. Gordon Obie me advertiu.

Jack fez uma pausa.

—Já foi decidido?

Ela assentiu.

Bill vai voltar para casa. Vou substituí-lo no próximo vôo. — Seu olhar se voltou para a UTI. — Eles têm dois filhos — mur­murou. — Ele não pode ficar lá em cima. Não por mais três meses.

—Você não está pronta. Você não teve tempo...

—Estarei.

Ela deu-lhe as costas.

Emma.

Jack estendeu a mão para detê-la, e seu toque a pegou de surpresa. Emma se voltou, e ele a soltou imediatamente.

—Quando vai para o Centro Espacial Kennedy? — perguntou.

—Uma semana. Quarentena.

Ele parecia atônito. Permaneceu calado, ainda tentando digerir as notícias.

—Isso me faz lembrar — disse ela. — Poderia tomar conta do Humphrey enquanto eu estiver fora?

—Por que não o põe em um gatil?

—É cruel manter um gato confinado durante três meses.

—lá aparou as unhas daquele monstrinho?

—Ora vamos, Jack. Ele só destrói as coisas quando se sente ignorado. Preste atenção nele, e ele deixará a sua mobília em paz.

Jack ergueu a cabeça ao ouvir a chamada no alto-falante:

—Dr. McCallum, compareça à emergência. Dr. McCallum, compareça à emergência.

—Acho melhor você ir — disse ela, já lhe dando as costas.

—Espere. Isso está acontecendo muito rapidamente. Não tivemos tempo de conversar.

—Se é sobre o divórcio, meu advogado pode responder qualquer pergunta enquanto eu estiver fora.

—Não. — Ele a assustou com seu tom de voz irritado. — Não, eu não quero falar com seu advogado!

—Então, o que precisa me dizer?

Ele a olhou um instante, como se buscando as palavras.

—É sobre esta missão — disse afinal. — Está acontecendo rápido demais. Não me parece certo.

—Como assim?

—Você é uma substituta de última hora. Você vai subir com uma tripulação diferente.

—Vance tem uma tripulação entrosada. Estou tranquila quanto ao lançamento.

—E quanto à estação? Isso pode estender a sua estadia em órbita para seis meses.

—Posso me virar.

—Mas não foi planejado. Foi decidido no último minuto.

—O que está querendo que eu faça, Jack? Desistir?

—Não sei! — Ele passou a mão na cabeça em sinal de frustração. — Eu não sei.

Ficaram em silêncio um instante, nenhum deles muito certo do que deveria dizer, embora nenhum dos dois estivesse pronto para terminar a conversa. Sete anos de casamento, pensou, reduzi­dos a isto. Duas pessoas que não podem ficar juntas, mas que não conseguem se separar. E agora não há mais tempo para ajeitarmos as coisas entre nós.

Uma nova mensagem foi ouvida no alto-falante:

— Dr. McCallum, compareça imediatamente à emergência.

Jack olhou para ela com uma expressão de dor.

Emma...

—Vá, Jack. Eles precisam de você.

Ele deu um gemido de frustração e saiu correndo em direção à emergência.

Ela deu meia-volta e caminhou na direção contrária.

 

12 de julho

A bordo da ISS

Pelas janelas de observação da cúpula do Nodo 1, o Dr. William Haning via nuvens rodopiando sobre o oceano Atlântico 350 quilômetros mais abaixo. Ele estendeu a mão, e seus dedos tocaram a barreira de vidro que o protegia do vácuo do espaço. Era mais um obstáculo a separá-lo de sua casa. De sua mulher. Observou a Terra lá embaixo, viu o oceano Atlân­tico se afastar, lentamente substituído pelo Norte da África e, a seguir, pelo oceano Índico, sobre o qual se aproximava a escuri­dão noturna. Embora seu corpo flutuasse pela ausência de gravi­dade, o fardo da dor parecia pressionar-lhe o tórax, dificultando sua respiração.

Naquele momento, em um hospital de Houston, sua mulher lutava pela vida, e ele nada podia fazer para ajudá-la. Estaria pre­so ali nas próximas duas semanas, capaz de ver a cidade onde Debbie podia estar morrendo, embora incapaz de alcançá-la, de tocá-la. O melhor que podia fazer era fechar os olhos e tentar imaginar estar ao lado dela e de mãos dadas.

Você tem de resistir. Você tem de lutar. Estou voltando para casa para ficar ao seu lado.

Bill? Você está bem?

Ele se voltou e viu Diana Estes flutuar do módulo do laboratório americano até o nodo onde ele estava. Ficou surpreso por ser ela quem lhe fazia aquela pergunta. Mesmo depois de um mês de convivência tão próxima, ele não se entendia com a inglesa. Era muito fria, muito objetiva. Apesar de ser uma bela loura platina­da, não era uma mulher pela qual se sentisse atraído, e Diana cer­tamente não o brindou com qualquer vestígio de interesse. De qualquer modo, a atenção dela geralmente estava voltada para Michael Griggs. O fato de Griggs ter uma mulher esperando por ele na Terra parecia irrelevante para ambos. Lá em cima, na ISS, Diana e Griggs eram como duas metades de uma estrela binária, orbitando uma em volta da outra, unidas por alguma poderosa atração gravitacional.

Esta era uma das infelizes realidades de ser um entre seis seres humanos de quatro países diferentes confinados no mesmo espa­ço. Sempre havia alianças e pactos em jogo, uma sensação de nós contra eles. O estresse de viverem confinados por tanto tempo afetava cada um de modo diferente. Ultimamente, o russo Nicolai Rudenko, que era quem estava na ISS havia mais tempo, tor­nara-se mal-humorado e irritadiço. Kenichi Hirai, da NASDA do Japão, estava tão frustrado com seu péssimo inglês que frequen­temente se fechava em um silêncio incômodo. Apenas Luther Ames continuava amigo de todo mundo. Quando Houston trans­mitiu as péssimas notícias sobre Debbie, foi Luther quem instin­tivamente soube o que dizer para Bill, aquele que falou ao seu coração, para o que ele tinha de humano. Luther nascera no Alabama, filho de um pastor negro muito querido, e herdara do pai o dom de consolar as pessoas.

—Não há o que discutir, Bill — dissera-lhe Luther. — Você tem de voltar para casa para ficar com a sua mulher. Diga para Houston que é melhor enviarem a limusine para buscá-lo, ou terão de se ver comigo.

Diana reagiu de modo completamente diferente. Sempre racional, ela calmamente ressaltou que não havia nada que Bill pu­desse fazer para acelerar a recuperação da mulher. Debbie estava comatosa, ela sequer saberia que ele estava lá. Tão fria e inflexível quanto os cristais que cultivava em seu laboratório, era o que Bill pensava a respeito dela.

Foi por isso que ficou intrigado com a preocupação de Diana.

Ela permaneceu no nodo, distante como sempre, longos cabelos louros flutuando como algas marinhas diante de seu rosto.

Ele voltou-se para a janela outra vez.

—Estou esperando Houston aparecer — disse.

—Você recebeu novos e-mails do centro de operações de carga útil.

Ele não respondeu. Apenas olhou para as luzes tremeluzentes de Tóquio, cidade que então estava posicionada no limiar da aurora.

Bill, há assuntos que requerem a sua atenção. Se não cui­dar deles, teremos que dividir as suas tarefas entre nós.

Tarefas. Então era isso que ela queria discutir. Não a dor que ele sentia, mas sim se podia contar com ele para realizar as tarefas que lhe eram designadas no laboratório. Cada dia a bordo da ISS era cuidadosamente planejado, com pouco tempo livre para re­flexões ou para o pesar. Se um membro da tripulação estava inca­pacitado, os outros tinham de se ocupar de suas tarefas ou as ex­periências seriam abandonadas.

—Às vezes, o trabalho é a melhor coisa para controlar a dor — disse Diana, com lógica cristalina.

Ele tocou o vidro à altura do brilho difuso das luzes de Tóquio.

—Não finja ter um coração, Diana. Você não engana ninguém.

Por um instante ela não disse nada. Ouviam apenas o contínuo ruído de fundo da estação espacial, um som com o qual esta­vam tão acostumados que agora mal se davam conta.

—Compreendo que está passando por maus bocados — dis­se ela calmamente. — Sei que não é fácil ficar preso aqui em cima, sem ter como voltar para casa. Mas não há nada que você possa fazer a respeito. Só lhe resta esperar pelo ônibus espacial.

Ele sorriu com amargura.

—Por que esperar quando posso estar em casa em quatro horas?

—Ora vamos, Bill. Seja razoável.

—Estou sendo. Basta eu entrar no CRV e ir embora.

—E nos deixar sem uma nave salva-vidas? Você não está pensando com clareza.

Ela fez uma pausa.

—Sabe, talvez você se sentisse melhor se tomasse algum medicamento. Apenas para ajudá-lo a atravessar este período.

Ele virou para ela, toda a sua dor, todo o seu pesar dando lugar à raiva.

—Tomar uma pílula e resolver tudo, certo?

—Pode ajudar, Bill. Só preciso ter certeza de que não fará nada de irracional.

—Vá se foder, Diana.

Ele pegou impulso para sair da cúpula e passou flutuando por ela em direção à entrada do laboratório.

—Bill!

—Como você disse tão gentilmente, tenho trabalho a fazer.

—Eu já disse que podemos dividir as suas tarefas. Se não está se sentindo apto para...

—Farei a droga do meu trabalho!

Bill flutuou até o laboratório americano e sentiu-se aliviado ao ver que ela não o seguiu. Olhando para trás, ele a viu flutuar em direção ao módulo habitacional, sem dúvida para verificar a situação do veículo de resgate da tripulação. Capaz de abrigar to­dos os seis astronautas, o CRV seria o seu único barco salva-vidas caso uma catástrofe ocorresse na estação. Ele a assustara com aquela conversa de sequestrar o veículo e lamentava tê-lo feito. Agora ela ficaria de olho nele, em busca de sinais de distúrbio emocional.

Já era desagradável o bastante estar preso naquela lata de sardinha de luxo 350 quilômetros acima da Terra. Ser visto com sus­peita só piorava tudo. Podia estar desesperado para voltar para casa, mas não estava perturbado. Todos aqueles anos de treina­mento e testes de avaliação psicológica confirmavam o fato de que Bill Haning era um profissional. Ele certamente não era o tipo de sujeito que colocaria em risco a vida dos colegas.

Tomou impulso apoiando-se em uma parede e flutuou atra­vés do módulo do laboratório até seu local de trabalho. Ali, verificou os últimos e-mails. Diana estava certa em um ponto: o tra­balho o faria deixar de pensar em Debbie.

A maioria dos e-mails era do Centro de Pesquisa Biológica Ames da NASA, na Califórnia, e as mensagens eram pedidos ro­tineiros de confirmação de dados. Muitas das experiências eram controladas do solo, e às vezes os cientistas questionavam os da­dos recebidos. Verificou as mensagens, fazendo uma careta ao ver a solicitação de mais amostras de fezes e urina dos astronau­tas. Continuou a verificar e parou na mensagem seguinte.

Aquela era diferente. Não vinha da Ames, mas de um centro de operações de carga útil do setor privado. Várias indústrias do setor privado pagavam para que fossem realizadas experiências a bordo da estação, e ele frequentemente recebia e-mails de cientis­tas que não eram da NASA.

Aquela mensagem era do SeaScience, em La Jolla, Califórnia.

Para: Dr. William Haning, ISS Biociência

De: Helen Koenig, Pesquisadora Principal

Re: Experimento CUC#23 (Cultura de Células Archaeons)

Mensagem: Os dados que baixamos recentemente indicam um

aumento rápido e inesperado na massa desta cultura de células.

Por favor, confirmar com o instrumento de medição de micro-massas que têm a bordo.

Outro pedido para mover uma alavanca, pensou com irritação. Muitas das experiências orbitais eram controladas por comandos enviados por cientistas no solo. Os dados dos diversos aparelhos do laboratório eram gravados em vídeo ou em dispositivos auto­máticos de amostragem, e os resultados eram transmitidos dire­tamente para os pesquisadores em terra. Com todo aquele equi­pamento sofisticado a bordo da ISS, falhas ocasionais eram inevitáveis. Aquele era o verdadeiro motivo dos seres humanos serem necessários lá em cima: para resolverem os problemas dos temperamentais equipamentos eletrônicos.

Abriu o arquivo CUC#23 do computador de carga útil e revisou o protocolo. As células em cultura eram Archaeons, organis­mos marinhos bacterianos recolhidos em chaminés hidrotermais em águas profundas. Eram inofensivos para os seres humanos.

Ele flutuou através do laboratório até a unidade de cultura de células e cravou os pés descalços nos estribos para manter a posi­ção. A unidade era um aparelho em forma de caixa com sistema próprio de manejo e descarga de fluidos para aspergir continua­mente duas dezenas de culturas celulares e amostras de tecido. A maioria das experiências era completamente independente e não precisava de intervenção humana. Em quatro semanas a bordo da ISS, Bill só olhara o tubo 23 uma única vez.

Ele abriu a bandeja da câmara de amostras celulares. Lá dentro, havia 24 tubos de cultura dispostos ao redor da periferia da unidade. Ele identificou o tubo 23 e removeu-o da bandeja.

Ficou imediatamente alarmado. A tampa parecia estufada, como se estivesse sob pressão. Em vez de um líquido ligeiramen­te turvo, que era o que esperava ver, o conteúdo era de um vívi­do azul-esverdeado. Virou o tubo de cabeça para baixo e a cultu­ra não se moveu. Não era mais líquida e, sim, grosseiramente viscosa.

Ele calibrou o aparelho de medição de micromassas e introduziu o tubo no compartimento de amostras. Pouco depois, os dados surgiram na tela.

Algo está muito errado, pensou. Houve algum tipo de contami­nação. Ou a amostra original de células não era pura, ou outro or­ganismo conseguiu entrar no tubo e destruir a cultura primária. Ele digitou a resposta para a Dra. Koenig.

... Os dados que recebeu se confirmam. A cultura parece drastica­mente alterada. Não é mais líquida. Parece ter se tornado uma massa gelatinosa azul-esverdeada, clara, quase brilhante. Deve ser considerada a possibilidade de contaminação...

Ele fez uma pausa. Havia outra possibilidade: o efeito da micro-gravidade. Na Terra, culturas de tecido tendem a crescer em lâ­minas planas, expandindo-se em apenas duas dimensões na su­perfície de seus recipientes. No espaço, livre dos efeitos da gravidade, aquelas mesmas culturas se comportavam de modo diferente. Cresciam em três dimensões, tomando formas que ja­mais poderiam assumir na Terra.

E se o tubo 23 não estivesse contaminado? E se esse fosse apenas o modo como os Archaeonsse comportavam na ausência da gravidade que os mantinha?

Quase imediatamente abandonou a hipótese. Aquelas mudanças eram drásticas demais. Apenas a falta de peso não podia ter transformado um organismo unicelular naquela insólita mas­sa esverdeada.

Escreveu:

... Enviarei uma amostra da cultura do tubo 23 para você no próximo vôo do ônibus espacial. Por favor, avise se tiver mais instruções...

O barulho repentino de uma gaveta o assustou. Ele se virou e viu Kenichi Hirai trabalhando em sua bancada de pesquisas. Estaria ali havia quanto tempo? Ele entrara tão sorrateiramente no laboratório que Bill não o percebera. Em um mundo onde não há em cima ou embaixo, onde nunca se ouvem sons de passos, uma saudação ver­bal às vezes é o único meio de alertar os outros de sua presença.

Ao perceber que Bill olhava para ele, Kenichi saudou-o simplesmente com um menear de cabeça e continuou a trabalhar. O silêncio do sujeito irritou Bill. Ele era como o fantasma residente da estação, vagando por ali sem emitir palavra e assustando todo mundo. Bill sabia que aquilo se devia ao fato de Kenichi estar inseguro ao ter que falar em inglês e, para evitar a humilhação, conversava pouco ou quase nada. Ainda assim, podia ao menos dizer "olá" ao entrar em um módulo, para evitar assustar os cinco colegas.

Bill voltou a atenção para o tubo 23. Como seria aquela mas­sa gelatinosa vista no microscópio?

Introduziu o tubo 23 na caixa de plexiglas, fechou a compor­ta e inseriu as mãos nas luvas embutidas. Se houvesse algum vazamento, ficaria confinado à caixa. Fluidos flutuando livremente na microgravidade podiam provocar um desastre na fiação elétri­ca da estação. Cuidadoso, afrouxou a tampa do tubo. Sabia que o conteúdo estava sob pressão. Podia ver a tampa estufada. Ainda assim, assustou-se quando a tampa subitamente estourou como uma rolha de champanhe.

Ele se lançou para trás quando uma massa compacta azul- esverdeada se chocou contra o interior da caixa de luvas. Ficou ali agarrada por um instante, palpitando como se estivesse viva. E estava mesmo viva, uma massa de microrganismos unidos em uma matriz gelatinosa.

Bill, precisamos conversar.

A voz o assustou. Rapidamente, ele voltou a tampar o tubo de cultura e voltou-se para Michael Griggs, que acabara de entrar no módulo. Flutuando bem atrás dele estava Diana. As pessoas boni­tas, pensou Bill. Ambos pareciam bem-dispostos e atléticos, ves­tindo camisas azul-marinho e bermudas azul-cobalto da NASA.

—Diana me disse que você está com problemas — disse Griggs. — Acabamos de falar com Houston, e eles acham que talvez fosse melhor você considerar a hipótese de tomar algum medicamento. Apenas para ajudá-lo a passar os próximos dias.

—Assustaram o pessoal lá em Houston, não é mesmo?

—Estão preocupados com você. Todos estamos.

—Veja, o que falei sobre o CRV era puro sarcasmo.

—Mas deixou todo mundo nervoso.

—Não preciso de Valium. Apenas me deixem em paz.

Removeu o tubo da caixa de luvas e devolveu-a ao seu lugar na unidade de cultura de células. Estava irritado demais para tra­balhar naquilo.

—Precisamos confiar em você, Bill. Dependemos uns dos outros aqui em cima.

Furioso, Bill os encarou.

—Vocês estão vendo um louco furioso à sua frente? É isso?

—No momento, você só consegue pensar em sua mulher. Compreendo isso. E...

—Você não compreende. Duvido que tenha pensado muito em sua mulher ultimamente.

E lançou um olhar malicioso para Diana. A seguir, projetou- se através do módulo e entrou no nodo de conexão. Começou a entrar no módulo habitacional, mas parou ao ver que Luther es­tava lá dentro, preparando o almoço.

Não há onde se esconder. Nenhum lugar onde ficar a sós.

Com lágrimas repentinas nos olhos, recuou e voltou à cúpula.

Dando as costas para os demais, olhou para a Terra através das janelas. A costa do Pacífico começava a aparecer. Outro nascer do sol, outro crepúsculo.

Outra eternidade de espera.

Kenichi observou Griggs e Diana flutuarem para fora do módulo do laboratório impulsionados por um empurrão bem dosado. Moviam-se com graça, como deuses louros. Frequentemente ele os observava quando não estavam olhando. Em particular, gosta­va de olhar para Diana Estes, uma mulher tão loura e pálida que parecia translúcida.

Sua partida o deixou sozinho no laboratório e ele pôde relaxar. Muitos conflitos naquela estação. Aquilo perturbava os seus nervos e afetava a sua concentração. Era uma pessoa tranquila por nature­za, um homem que se contentava em trabalhar sozinho. Embora entendesse inglês razoavelmente bem, tinha dificuldade para se ex­pressar naquele idioma e achava as conversas muito cansativas. Ficava muito confortável trabalhando sozinho e em silêncio, ape­nas com a companhia dos animais do laboratório.

Olhou através da janela de observação para os ratos no vivei­ro e sorriu. De um lado da divisória de tela havia 12 machos e, do outro, 12 fêmeas. Quando era criança, no Japão, criara coelhos e gostava de aninhá-los no colo. Aqueles ratos, porém, não eram animais de estimação e estavam isolados do contato humano. Seu ar era filtrado e condicionado antes de se misturar ao ambiente da estação espacial. Todo manuseio de animais era feito na caixa de luvas, lugar onde todos os espécimes biológicos, de bactérias a ratos de laboratório, podiam ser manipulados sem risco de con­taminarem o ar da estação.

Aquele era dia de tirar amostras de sangue. Não era um trabalho que ele gostasse de fazer, porque envolvia furar a pele dos ratos com uma agulha. Ele murmurou uma desculpa em japonês, introduziu as mãos nas luvas e transferiu o primeiro rato para a área de trabalho. O animal lutou, tentando escapar de sua mão. Ele o soltou, permitindo que flutuasse livremente enquanto pre­parava a agulha. Era algo triste de se ver, o rato movendo os membros freneticamente, tentando impulsionar-se para a frente. Não tendo onde se apoiar, vagou indefeso pelo ar.

Com a agulha pronta, ergueu a mão enluvada para recapturar o rato. Somente então notou o glóbulo azul-esverdeado flutuan­do ao lado do animal. Tão perto que o rato deu-lhe uma lambida com sua língua cor-de-rosa. Kenichi riu. Beber glóbulos flutuan­tes era algo que os astronautas faziam para se divertirem e era o que o rato parecia estar fazendo agora, divertindo-se com o novo brinquedo.

Então, perguntou-se: de onde viera aquela substância azul-esverdeada? Bill andara usando a caixa de luvas. Seria algo tóxico?

Kenichi flutuou até o terminal de computador e olhou para o protocolo da experiência que Bill requisitara por último. Era o da CUC#23, uma cultura de células. O protocolo assegurava que o glóbulo nada continha de perigoso. Archaeonseram organis­mos marinhos unicelulares e inofensivos, sem propriedades infecciosas.

Satisfeito, voltou à caixa de luvas, inseriu as mãos ali dentro e pegou uma agulha.

 

16 de julho

Não temos sinal da nave para a Terra.

Jack olhou para a esteira de fumaça maculando o céu azul e o terror tomou conta de sua alma. O sol batia-lhe no rosto, mas seu suor estava frio como gelo. Ele vasculhou o céu. Onde estava o ônibus espacial? Havia apenas alguns segundos, sentira o chão tremer com o estrondo do lançamento e observara o arco que traçara ao cruzar o céu sem nuvens. Enquanto subia, levava também o seu coração, impulsionado pelo rugido dos fo­guetes, e ele seguiu a sua trajetória rumo ao céu até tornar-se ape­nas um pequeno ponto que refletia a luz do sol.

Não conseguia mais vê-lo. O que fora uma linha reta de fumaça branca transformara-se agora em uma linha serrilhada de fumo negro.

Ele vasculhou o céu freneticamente e divisou um vertiginoso redemoinho de imagens. Fogo no céu. Um tridente diabólico de fumaça. Destroços caindo no mar.

Não temos sinal da nave para a Terra.

Ele acordou, ofegante, o corpo banhado de suor. Já era dia e o sol brilhava, radiante, através da janela de seu quarto.

Com um gemido, sentou-se na beirada da cama e segurou a cabeça entre as mãos. Não ligara o ar-condicionado na véspera e agora o quarto estava quente como um forno. Cambaleou pelo quarto para acionar o interruptor, então voltou a afundar na cama e suspirou aliviado quando o ar frio começou a sair do aparelho.

O velho pesadelo.

Esfregou o rosto, tentando afastar as imagens da mente, mas elas estavam muito profundamente gravadas em sua memória. Ele era calouro na faculdade quando a Challenger explodiu: esta­va caminhando pelo saguão dos dormitórios quando as primei­ras imagens do desastre foram divulgadas pela televisão. Naquele dia, e nos dias que se seguiram, diversas vezes observara horrori­zado aquelas mesmas imagens, que se cristalizaram tão profun­damente em seu subconsciente, tornando-se tão reais para ele quanto para as pessoas que estavam nas arquibancadas do Cabo Canaveral naquela manhã.

Agora, a lembrança voltara à tona em seus pesadelos.

É por causa do lançamento de Emma.

No chuveiro manteve a cabeça debaixo de um poderoso fluxo de água fria, esperando que os últimos vestígios de pesadelo fos­sem levados pela torrente. Tiraria férias de 21 dias a partir da se­mana seguinte, mas não estava nem um pouco animado com aquilo. Não saía com o veleiro havia meses. Talvez algumas se­manas a bordo, longe do brilho das luzes da cidade, fosse a me­lhor terapia. Apenas ele, o mar e as estrelas.

Fazia muito tempo que não observava as estrelas. Ultimamente, parecia evitar até mesmo olhar para elas. Quando criança, seus olhos estavam sempre voltados para o céu. Sua mãe contava que Jack, quando criança, certa noite fora ao jardim e estendera as mãos, tentando pegar a lua. Como não conseguiu, chorou de frustração.

A lua, as estrelas, a escuridão do espaço. Tudo isso continua va além de seu alcance agora, e ele frequentemente se sentia como aquele menino que fora outrora, chorando de frustração, com os pés presos à Terra e as mãos ainda estendidas para o céu.

Desligou o chuveiro e pressionou as mãos contra os azulejos, cabeça baixa, cabelo pingando. Hoje é dia 16 de julho, pensou. O lançamento de Emma será daqui a oito dias. Sentiu a água resfriar-lhe a pele.

Em dez minutos, estaria vestido e dentro de seu carro.

Era terça-feira. Emma e sua nova equipe de vôo estariam terminando a simulação integrada de três dias e ela estaria cansada e sem vontade de vê-lo. No dia seguinte, porém, estaria a caminho do Cabo Canaveral. No dia seguinte, estaria incomunicável.

No Centro Espacial Johnson, parou o carro no estacionamento do Prédio 30, mostrou o crachá da NASA para o segurança e subiu a escada até a sala de controle de vôo do ônibus espacial. Lá dentro, encontrou todos apressados e tensos. A simulação integrada de três dias era como um exame final tanto para os astronautas quanto para a equipe de controle de terra, um ensaio repleto de crises no qual reproduziam toda a missão desde o lançamento até a aterrissa­gem, com a adição proposital de falhas para manter todos alertas. Três turnos de controladores se revezaram diversas vezes naquela sala nos últimos três dias, e os 24 homens e mulheres que então estavam sentados diante dos consoles pareciam arrasados. A lixeira estava superlotada de copos de café e latas de Pepsi diet. Embora alguns controladores tivessem visto Jack e meneado a cabeça em sua direção, não havia tempo para cumprimentos de verdade, estavam com uma grande crise em mãos, e a atenção de todos estava voltada para o problema. Era a primeira vez em meses que Jack visitava a sala de controle de vôo, e novamente sentiu a antiga excitação, a eletricidade que parecia crepitar naquela sala sempre que havia uma missão em curso.

Foi até a terceira fileira de consoles, para ficar ao lado do diretor de vôo, Randy Carpenter, que no momento estava muito ocupado para falar com ele.

Carpenter era o sumo sacerdote dos diretores de vôo do progra­ma do ônibus espacial. Com 140 quilos, era uma figura imponente na sala, a barriga transbordando sobre o cinto, os pés afastados como um capitão de navio equilibrando-se na ponte de comando. Naquela sala, Carpenter estava no comando. Gostava de dizer: "Sou o melhor exemplo de quão longe um menino gordo de óculos pode chegar na vida." Diferente do lendário diretor de vôo Gene Kranz, cuja frase "O fracasso não é uma opção" o fez tornar-se um impro­vável herói da mídia, Carpenter só era conhecido dentro da NASA. Sua falta de qualidades fotogênicas o tornava um improvável herói de cinema, não importando a circunstância.

Ouvindo o que falavam, Jack rapidamente entendeu a natureza da crise com que Carpenter estava lidando no momento. Jack enfrentara um problema semelhante em sua própria simula­ção integrada havia dois anos, quando ainda fazia parte do plan­tel de astronautas, preparando-se para a STS 145. A tripulação do ônibus espacial relatara uma súbita queda de pressão na cabine, indicando um rápido vazamento de ar. Não havia tempo para detectar a origem. Em vez disso, tinham de proceder a uma saída de órbita de emergência.

Sentado em frente a uma fileira de consoles conhecida como a Trincheira, o encarregado de dinâmica de vôo rapidamente ve­rificava as trajetórias de voo para determinar o melhor local de aterrissagem. Ninguém considerava aquilo um jogo. Todos sa­biam que, se tal crise fosse real, as vidas de sete pessoas estariam ameaçadas.

—Pressão da cabine em 13,9 psi — anunciou o controle ambiental.

—Base da Força Aérea de Edwards — anunciou a dinâmica de vôo. — Aterrissagem a aproximadamente 1.300.

—Nesse ritmo, a pressão da cabine chegará a menos de 7 psi — informou o controle ambiental.

—Recomendamos que ponham os capacetes agora, antes de iniciarem a sequência de reentrada.

O Capcom transmitiu o conselho para a Atlantis.

— Entendido — respondeu o comandante Vance. — Capacetes postos. Estamos iniciando a queima para saída de ór­bita.

Contra a sua vontade, Jack foi arrebatado pela urgência do jogo. À medida que os segundos passavam, tinha o olhar fixo na tela principal na frente da sala, onde o caminho do veículo or­bital era traçado em um mapa-múndi. Embora soubesse que toda a crise era artificialmente introduzida por uma maliciosa equipe de simulação, a seriedade do exercício o havia contagia­do. Mal se dera conta de que seus músculos haviam ficado ten­sos à medida que se concentrava nos dados que passavam pela tela.

A pressão da cabine caiu para 7 psi.

A Atlantis atingiu a atmosfera superior. Estavam em blecaute de rádio, 12 longos minutos de silêncio quando a fricção da reen­trada ionizava o ar ao redor do veículo orbital, interrompendo todas as comunicações.

—Atlantis, está me ouvindo? — perguntou o Capcom.

De repente, ouviu-se a voz do comandante Vance:

—Ouvimos alto e claro, Houston.

A aterrissagem, momentos depois, foi perfeita. Fim de jogo.

Os aplausos tomaram conta da sala de controle de vôo.

—Muito bem, pessoal, bom trabalho — disse o diretor de vôo, Carpenter. —Reunião às 15 horas. Pausa para almoço. — Sorrindo, ele tirou o fone de ouvido e pela primeira vez olhou para Jack. —Ei, faz um tempão que não o vejo por aqui.

—Tenho atendido civis.

—Ganhando um dinheirão, hein?

Jack sorriu.

—É mesmo. Mas diga-me o que fazer com todo esse dinhei­ro. — Ele olhou para os controladores de vôo ao seu redor, agora relaxados em seus consoles, tomando refrigerantes e comendo lanches trazidos de casa. — A simulação foi boa?

—Estou feliz. Superamos todas as falhas.

—E a tripulação do ônibus espacial?

—Estão prontos. — Carpenter olhou-o apreensivo. — Inclusive Emma. Ela está em seu elemento, Jack; portanto, não a perturbe. Agora ela precisa se concentrar.

Aquilo fora do mais que um conselho amistoso. Fora uma advertência. Guarde os seus assuntos pessoais. Não arruine o moral de minha tripulação.

Debaixo de um sol escaldante, Jack sentia-se desestimulado, até mesmo um tanto arrependido, enquanto esperava Emma emergir do Edifício 5, que abrigava os simuladores de vôo. Ela saiu com o resto da tripulação.

Obviamente acabavam de ouvir uma piada, pois estavam todos rindo. Então, ela viu Jack e o sorriso se desfez.

—Não sabia que viria — disse ela.

Ele deu de ombros e disse, timidamente:

—Nem eu.

—Reunião em dez minutos — disse Vance.

—Estarei lá — respondeu Emma. — Vão na frente.

Ela esperou a equipe se afastar, então se voltou para Jack outra vez.

—Realmente preciso me juntar a eles. Veja, eu sei que esse lançamento complica tudo. Se você estiver aqui para falar dos docu­mentos do divórcio, prometo que eu os assinarei assim que voltar.

—Não foi por isso que eu vim.

—Algum outro motivo, então?

Ele fez uma pausa.

— É. Humphrey. Qual o nome do veterinário dele? Caso engula uma bola de pelo ou algo assim.

Ela olhou-o, perplexa.

—É o mesmo veterinário de sempre, o Dr. Goldsmith.

—Ah, é mesmo.

Ficaram em silêncio um instante, o sol brilhando sobre as suas cabeças. O suor escorria-lhes pelas costas. Ela subitamente pareceu-lhe pequena e frágil. Contudo, aquela era uma mulher que se jogara de um avião. Ela o superava na equitação, rodava ao redor dele na pista de dança. Sua bela e corajosa esposa.

Ela se voltou para olhar para o Prédio 30, onde a equipe a esperava.

—Tenho de ir, Jack.

—A que horas vai para o Cabo Canaveral?

—Às 6 horas.

—Todos os seus primos irão ao lançamento?

—Claro.

Ela fez uma pausa.

—Você não estará lá, certo?

O pesadelo da Challenger ainda estava fresco em sua mente, os rolos de fumaça negra maculando o céu azul. Não poderei ver isso, pensou. Não consigo lidar com a possibilidade.

Ele sacudiu a cabeça em negativa.

Ela aceitou a resposta com um frio gesto de cabeça e um olhar que dizia: Posso parecer tão desinteressada quanto você. E voltou- se para ir embora.

Emma. — Ele a pegou pelo braço e girou-a delicadamente. — Vou sentir saudades suas.

Ela suspirou.

—Claro, Jack.

—Vou mesmo.

—Você passa semanas sem me ligar e agora diz que vai sentir a minha falta?

Ela riu.

Jack sentiu amargura em sua voz. E a verdade de suas palavras. Nos últimos meses ele de fato a evitara. Era doloroso ficar por perto porque o sucesso dela apenas aumentava a sua sensação de fracasso.

Não havia esperança de reconciliação, percebia agora, na frieza do olhar dela. Nada a fazer a não ser agir com civilidade em relação a tudo aquilo.

Ele desviou o olhar, subitamente incapaz de encará-la.

—Só vim desejar uma viagem segura. É um ótimo passeio. Acene para mim de vez em quando ao sobrevoar Houston. Esta­rei olhando para você.

Vista da Terra, a ISS parecia uma estrela em movimento, mais clara que Vénus, atravessando o céu.

—Você também acene, está bem?

Ambos conseguiram sorrir. Seria uma despedida civilizada, afinal de contas. Jack estendeu os braços, e ela se inclinou para que ele a abraçasse. Foi um abraço breve e desajeitado, como se fossem estranhos que tivessem acabado de se conhecer. Ele sen­tiu o corpo dela, tão quente e vivo, pressionado contra o seu. Então ela se afastou e caminhou em direção ao prédio do con­trole da missão.

Emma fez uma única pausa para acenar-lhe adeus. A luz do sol caía diretamente sobre seus olhos e, ofuscado pela claridade, viu-a como uma silhueta escura, cabelos levados pelo vento quente. Então, soube que jamais a amara tanto quanto naquele momento em que a observava se afastar.

 

19 de julho

Cabo Canaveral

Mesmo a distância, a visão tirou o fôlego de Emma. Aprumado na plataforma de lançamento 39B, iluminado por potentes refletores, o ônibus espacial Atlantis, acoplado ao seu gigan­tesco tanque de combustível alaranjado e à dupla de foguetes de combustível sólido, assemelhava-se a um imponente farol em meio à escuridão da noite. Não importava quantas vezes tivesse experimentado aquela sensação. Aquela primeira visão de um ônibus espacial iluminado na plataforma nunca deixou de impressioná-la.

O restante da tripulação, de pé ao lado dela no asfalto, estava igualmente silenciosa. Para alterarem os seus relógios biológicos, haviam despertado às 2 horas e saído de seus aposentos no tercei­ro andar do prédio de Operações e Partidas para darem uma olhada no colosso que os levaria ao espaço. Emma ouviu o grito de um pássaro noturno e sentiu um vento gelado soprar do golfo do México, refrescando o ar, afastando o cheiro de água parada dos pântanos que os cercavam.

—Faz a gente se sentir insignificante, não é mesmo? — perguntou o comandante Vance com seu ligeiro sotaque texano.

Os outros murmuraram, concordando.

—Pequeno como uma formiga — disse Chenoweth, o único novato da tripulação.

Aquela seria a sua primeira viagem a bordo do ônibus espacial, e ele estava tão excitado que parecia gerar o seu próprio cam­po de eletricidade.

—Sempre esqueço quão grande ela é. Então, dou outra olha­da e penso, meu Deus, todo esse poder. E eu sou o sortudo que vai andar nela. — Todos riram, mas com aquela risada contida e desajeitada de fiéis em uma igreja.

—Nunca achei que uma semana podia demorar tanto para passar — disse Chenoweth.

—Este cara está farto de ser virgem — disse Vance.

—Com certeza. Quero ir lá para cima. — O olhar de Chenoweth ergueu-se faminto para o céu. Para as estrelas. — Vocês to­dos conhecem o segredo, e não posso esperar para sabê-lo.

O segredo. Pertencia apenas aos poucos privilegiados que haviam subido ao espaço. Não era um segredo, que se pudesse compartilhar com outras pessoas. Você mesmo tinha de vivê-lo, observá-lo com seus próprios olhos, o negro do espaço e o azul da Terra lá embaixo. Ser esmagado contra o assento pelo impul­so dos foguetes. Os astronautas que voltam do espaço frequente­mente trazem um sorriso nos lábios, uma expressão que diz, ex­perimentei algo que poucos seres humanos terão a oportunidade de experimentar.

Emma sorria assim quando emergiu da escotilha da Atlantis havia mais de dois anos. Com pernas bambas, cami­nhou sob o sol e olhou para um céu incrivelmente azul. Em um período de oito dias a bordo do veículo orbital, presen­ciara mais de 130 auroras, vira incêndios florestais no Brasil, o olho de um furacão sobre as ilhas Samoa e admirara uma Terra que parecia tristemente frágil. Ela voltara mudada para sempre.

Em cinco dias, a não ser que houvesse uma catástrofe, Chenoweth conheceria o segredo.

—E hora de jogar alguma luz em nossas retinas — disse Chenoweth. — Meu cérebro ainda pensa que estamos no meio da noite.

—Estamos no meio da noite — disse Emma.

— Para nós é o romper da aurora, pessoal! — disse Vance.

De todos, ele fora o que mais rapidamente ajustara o seu relógio biológico aos novos horários de sono.

Vance começou a voltar para o prédio de Operações e Partidas para começar o dia de trabalho às 3 horas. Os outros o seguiram. Apenas Emma ficou para trás um instante, olhando para o ônibus espacial. No dia anterior, haviam ido à plataforma de lan­çamento para uma última revisão dos procedimentos de evasão da tripulação. De perto, à luz do sol, o ônibus espacial parecia muito grande e brilhante para ser visto de uma só vez. Só era possível se concentrar em apenas uma parte da nave a cada olha­da. A proa. As asas. Os ladrilhos negros como escamas reptilianas no bojo. A luz do dia, o ônibus espacial era real e sólido. Agora, parecia algo sobrenatural, iluminado contra a escuridão do céu.

Com todos os frenéticos preparativos, Emma não se permitira sentir apreensiva e banira firmemente a ansiedade. Estava pronta para subir. Queria subir. Mas agora sentia uma pontada de medo.

Ela olhou para o céu, viu as estrelas desaparecendo por trás de um véu de nuvens que avançava. O tempo estava mudando.

Com um arrepio, voltou-se e caminhou em direção ao pré­dio. Em direção à luz.

 

23 de julho

Houston

Meia dúzia de tubos entrava pelo corpo de Debbie Haning. Na garganta, um tubo de traqueotomia, através do qual o oxigênio era bombeado para os pulmões. Um tubo nasogástrico introdu­zido em sua narina esquerda atravessava o seu esôfago e ia até o estômago. Um cateter drenava a urina e dois cateteres endoveno­sos introduziam fluidos em suas veias. No pulso havia uma linha arterial e o osciloscópio monitorava continuamente sua pressão sanguínea. Jack olhou para os sacos intravenosos pendurados so­bre a cama e viu que continham poderosos antibióticos. Era um mau sinal. Significava que ela adquirira uma infecção, o que não é incomum em uma pessoa que passa duas semanas em coma. Cada brecha na pele, cada tubo de plástico, é um portal para bac­térias e, na corrente sanguínea de Debbie, travava-se agora uma batalha.

Com apenas um olhar, Jack compreendeu tudo, mas nada disse para a mãe de Debbie, que estava sentada ao lado da cama segurando a mão da filha. O rosto de Debbie estava flácido, a mandíbula frouxa, as pálpebras apenas parcialmente fechadas. Permanecia profundamente comatosa, sem se dar conta de nada, nem mesmo da dor.

Quando Jack entrou no cubículo, Margaret voltou-se e cumprimentou-o com a cabeça.

—Ela teve uma noite ruim — disse ela. — Uma febre. Não sabem a origem.

—Os antibióticos ajudarão.

—E daí? Tratamos a infecção, mas o que acontece a seguir? — Margaret inspirou profundamente. — Ela não gostaria disso. Todos esses tubos. Todas essas agulhas. Ela gostaria que nós a deixássemos ir.

—Não é hora de desistir. O EEC ainda está ativo. Ela não tem morte cerebral.

—Então, por que não desperta?

-—Ela é jovem. Tem tudo pelo que viver.

—Isto não é viver. — Margaret olhou para a mão da filha. Estava repleta de hematoma, inchada por causa das agulhas intra­venosas. — Quando o pai dela estava à morte, Debbie me disse que não queria acabar assim, amarrada na cama e sendo alimen­tada à força. Fico pensando nisso. No que ela me disse... — Margaret voltou a erguer a cabeça. — O que você faria? Se fosse a sua mulher?

—Eu não pensaria em desistir.

—Mesmo se ela tivesse lhe dito que não queria acabar assim?

Ele pensou um instante. Então disse com convicção:

A minha decisão final seria essa. Não importando o que ela ou qualquer outra pessoa me dissesse. Não desistiria de alguém que amo. Nunca. Não se ainda houvesse a mínima chance de salvá-la.

Suas palavras não confortaram Margaret. Ele não tinha direi­to de questionar suas crenças, seus instintos, mas ela pedira uma opinião, e a resposta de Jack viera do coração, não de sua mente.

Sentindo-se culpado, então, ele deu um último tapinha no ombro de Margaret e deixou o cubículo. Seria a natureza quem provavelmente decidiria aquilo. Um paciente comatoso com uma infecção sistêmica está às portas da morte.

Jack deixou a UTI e entrou no elevador com a expressão sombria. Que modo deprimente de começar as férias. Primeira parada, decidiu ao chegar ao saguão, seria a mercearia da esqui­na, onde compraria seis latas de cerveja. Uma cerveja bem gelada e uma tarde carregando o veleiro era o que ele precisava então. Aquilo tiraria Debbie Haning de sua mente.

—Código azul, CTI cirúrgico. Código azul, CTI cirúrgico.

Ele se sobressaltou ao ouvir o anúncio no sistema de comunicação do hospital. Debbie, pensou, e subiu correndo as escadas.

O cubículo dela no CTI cirúrgico já estava lotado de gente. Ele entrou e deu uma olhada no monitor. Fibrilação ventricular! O coração dela era um feixe de músculos pulsantes, incapaz de bombear o sangue, incapaz de manter o cérebro vivo.

—Uma ampola de epinefrina entrando agora! — avisou uma das enfermeiras.

—Afastem-se todos! — ordenou um médico, posicionando os contatos do desfibrilador sobre o peito de Debbie.

Jack viu o corpo dela dar um solavanco no momento da descarga e viu uma linha reagir no monitor. Então, voltou a ficar reta. Ainda em fibrilação ventricular.

Uma enfermeira aplicava RCP, seu cabelo louro e curto balançando a cada pressão sobre o peito de Debbie. O neurologista, o Dr. Salomon, olhou para Jack quando este chegou à beira da cama.

—Administrou amiodarona? — perguntou Jack.

—Estamos administrando neste momento, mas não está funcionando.

Jack voltou a olhar para o monitor. A fibrilação ventricular ia de mal a pior. Piorando, numa linha reta.

—Já demos quatro choques — disse Salomon. — Não conseguimos ritmo.

—Epinefrina intracardíaca?

—Só nos resta rezar. Vá em frente!

A enfermeira preparou a seringa de epinefrina, na qual encaixou uma longa agulha cardíaca. Mesmo antes de pegar a seringa, Jack já sabia que haviam perdido aquela batalha. Aquele procedi­mento não mudaria coisa alguma. Mas pensou em Bill Haning, esperando para voltar à Terra para ficar com a esposa. E pensou no que dissera para Margaret havia alguns instantes.

Não desistiria de alguém que amo. Nunca. Não se houvesse a mínima chance de salvá-la.

Ele olhou para Debbie e, durante um momento constrangedor, a imagem do rosto de Emma passou por sua mente.

Ele engoliu em seco e disse:

— Interromper as compressões.

A enfermeira ergueu as mãos do externo.

Jack passou uma gaze com Betadine sobre a pele e posicionou a ponta da agulha sob o processo xifoide. Seu pulso se acelerou quando furou a pele. Introduziu a agulha no peito, exercendo suave pressão negativa.

Um fluxo de sangue indicou que atingira o coração.

Apertando o êmbolo, injetou toda a dose de epinefrina e retirou a agulha.

—Prossiga com as compressões — disse ele, e ergueu a cabe­ça para o monitor.

Vamos lá, Debbie. Lute, droga. Não desista. Não desista de Bill.

A sala estava silenciosa, todos os olhares voltados para o monitor. A linha ficou reta, o miocárdio morrendo, célula por célu­la. Ninguém precisou dizer uma palavra. Todos tinham uma ex­pressão de derrota no rosto.

Ela é tão jovem, pensou Jack. Tinha 36 anos.

A mesma idade de Emma.

Foi o Dr. Salomon quem tomou a decisão.

—Vamos acabar com isso — murmurou. — Hora da morte, 23h15.

A enfermeira que aplicava as compressões afastou-se solenemente do corpo. Sob as luzes brilhantes do cubículo, o tronco de Debbie parecia de feito de plástico. Um manequim. Não a mu­lher inteligente e ativa que Jack conhecera havia cinco anos em uma festa da NASA ao ar livre, sob as estrelas.

Margaret entrou no cubículo. Ficou um instante em silêncio, como se não reconhecesse a própria filha. O Dr. Salomon pousou a mão sobre o seu ombro e murmurou:

Foi muito rápido. Nada pudemos fazer.

Ele devia estar aqui — disse Margaret, a voz trêmula.

Tentamos mantê-la viva — disse o Dr. Salomon. — Lamento.

—É pelo Bill que estou lamentando — disse Margaret. A seguir, pegou a mão da filha e a beijou. — Ele devia estar aqui. Agora, jamais se perdoará.

Jack saiu do cubículo e afundou em uma cadeira no posto das enfermeiras. As palavras de Margaret ainda soavam em sua cabe­ça. Ele devia estar aqui. Agora, jamais se perdoará.

Ele olhou para o telefone. E o que eu ainda estou fazendo aqui?, perguntou-se.

Pegou as Páginas Amarelas sobre o balcão, ergueu o telefone do gancho e discou.

—Lone Star Travei — atendeu uma mulher. —Preciso ir para o Cabo Canaveral.

 

Cabo Canaveral

Pela janela do carro alugado, Jack inalou o ar úmido das florestas de Merritt ísland e sentiu cheiro de solo encharcado e vegetação. A entrada do Centro Espacial Kennedy era, surpreendentemente, uma estrada rural atravessando laranjais, estandes de donuts em ruínas e depósitos de ferro-velho repletos de pedaços de mísseis. Escurecia, e ele viu as lanter­nas traseiras de centenas de carros que se arrastavam pela estrada mais à frente. O trânsito estava piorando, e logo seu carro ficaria preso no engarrafamento de turistas que procuravam um lugar onde estacionar para assistir ao lançamento na manhã seguinte.

Não adiantava tentar atravessar aquela bagunça. Também não havia por que tentar chegar ao portão de Porto Canaveral. Àquela hora, os astronautas estariam dormindo. Chegara tarde demais para se despedir.

Ele deu meia-volta, fugindo do tráfego, e voltou para a auto-estrada AIA. A estrada para Cocoa Beach.

Desde os tempos de Alan Shepard e dos sete astronautas originais do projeto Mercury, Cocoa Beach era o centro festivo dos astronautas, uma faixa de hotéis, bares e lojas de camisetas um tanto arruinadas ao longo de uma faixa de terra entre o rio Bana­na, a oeste, e o oceano Atlântico, a leste. Jack conhecia bem o lu­gar, da Tokyo Steak House ao Moon Shot Bar. Outrora, correra na mesma praia onde John Glenn costumava se exercitar. Havia apenas dois anos, estivera em Jetty Park e olhara através do rio Banana para a plataforma de lançamento 39A. Para o seu ônibus espacial, o pássaro que supostamente o levaria ao espaço. Tais lembranças ainda eram enevoadas pela dor. Lembrou-se de uma longa corrida em uma tarde abrasadora. Da súbita e dolorosa pontada na lombar, uma agonia tão terrível que o fez cair de joe­lhos. Depois, em meio a uma névoa de narcóticos, o rosto grave do cirurgião de voo olhando para ele na emergência do hospital, dando-lhe as más notícias. Uma pedra no rim.

Ele fora retirado da missão.

Ainda pior, seu futuro no espaço estava comprometido. Um histórico de pedra no rim era uma das poucas condições que po­deriam vetar permanentemente um astronauta. A microgravidade causava mudanças fisiológicas nos fluidos corporais, resultan­do em desidratação. Também fazia os ossos minarem cálcio. Juntos, tais fatores aumentavam o risco de uma nova pedra nos rins enquanto ele estivesse no espaço — um risco que a NASA não queria correr. Embora ainda no corpo de astronautas, Jack ficou sem voar. Esperou mais um ano na esperança de ser chama­do para outro voo, mas nunca mais foi selecionado. Fora reduzi­do a um astronauta fantasma, condenado a vagar para sempre pelos corredores do Centro Espacial Johnson em busca de uma missão.

De volta ao presente. Lá estava ele, outra vez em Canaveral, não mais um astronauta e, sim, apenas outro turista descendo a AIA, faminto e mal-humorado, sem ter para onde ir. Todo hotel em um raio de mais de 60 quilômetros estava lotado, e ele estava cansado de dirigir.

Entrou no estacionamento do Hotel Hilton e foi até o bar.

O lugar melhorara consideravelmente desde a última vez que ele estivera ali. Tapetes e tamboretes novos, samambaias pendu­radas no teto. Antes era um lugar ligeiramente maltratado, um Hilton velho e cansado em uma área turística igualmente velha e cansada. Não havia hotéis de quatro estrelas em Cocoa Beach. Aquele era o lugar mais luxuoso que tinham por lá.

Pediu uísque e água e concentrou-se na TV sobre o bar. Estava sintonizada no canal oficial da NASA, e o ônibus espacial Atlantis ocupava a tela, iluminado pelos refletores, vapor fantas­magórico erguendo-se ao seu redor. O veículo que levaria Emma para o espaço. Ele olhou para a imagem, pensando nos quilôme­tros de fiação dentro daquele casco, nos inúmeros interruptores e barramentos de dados, parafusos, juntas e anéis de obstrução. Milhões de coisas podiam dar errado. Era uma maravilha que tão pouca coisa de fato desse errado, e que o homem, imperfeito como é, pudesse projetar e construir um aparelho tão confiável que sete pessoas desejassem viajar ali dentro.

Por favor, que esse lançamento seja perfeito, pensou. Um lança­mento no qual todos façam direito o seu trabalho, que nenhum pa­rafuso esteja frouxo. Tem de ser perfeito porque minha Emma esta­rá a bordo.

Uma mulher sentou-se no tamborete ao lado dele e disse:

—Imagino o que estarão pensando agora.

Ele se voltou para ela, seu interesse momentaneamente capturado por um relance de uma coxa. Ela era loura, esguia e bron­zeada, com um daqueles rostos perfeitos e sem graça cujos traços a gente esquece uma hora depois de irem embora.

—Quem está pensando o quê? — perguntou Jack.

—Os astronautas. Perguntou-me se estão pensando: "Ai, merda! No que fui me meter?"

Ele deu de ombros e bebeu um gole de uísque.

—Não estão pensando em nada agora. Estão todos dormindo.

—Eu não conseguiria dormir.

—O relógio biológico deles está completamente reajustado. Provavelmente foram para a cama há umas duas horas.

—Não, quero dizer que não conseguiria dormir de jeito nenhum. Ficaria deitada e acordada, pensando em um meio de sair dessa.

Ele riu.

—Pois eu lhe garanto que, se estiverem acordados, será porque não conseguem esperar para embarcar naquela belezinha e partir.

Ela olhou para ele com curiosidade.

—Você faz parte do programa, não é?

—Fiz. Eu era astronauta.

—Não é mais?

Ele levou o copo aos lábios, sentiu os cubos de gelo se chocarem com força contra seus dentes.

—Eu me aposentei.

Baixando o copo vazio, levantou-se e viu desapontamento nos olhos da mulher. Permitiu-se considerar durante um instante como o resto da noite poderia ser caso ele continuasse aquela con­versa. Companhia agradável. A promessa de algo mais a seguir.

Em vez disso, pagou a conta no bar e saiu do Hilton.

A meia-noite, na praia de Jetty Park, olhou através da água em direção à plataforma 39B. Estou aqui, pensou. Mesmo que você não saiba, estou aqui com você.

Ele se sentou na areia e esperou o amanhecer.

 

24 de julho

Houston

—Há um sistema de alta pressão sobre o golfo do México que manterá o céu claro sobre o Cabo Canaveral, o que possibilita um cancelamento com retomo ao local de lançamento. A base da Força Aérea em Edwards está com nuvens intermitentes, mas es­pera-se que se dissipem até o lançamento. O local de aterrissagem transatlântica em Zaragoza, na Espanha, ainda é viável e a previ­são é de que continue assim. O mesmo para o local de aterrissa­gem transatlântica em Morón, na Espanha. Ben Guerir, no Mar­rocos, experimenta ventos fortes e tempestades de areia e, no momento, não é um local de aterrissagem transatlântica viável.

O primeiro boletim meteorológico do dia, transmitido simultaneamente para o Cabo Canaveral, trazia notícias satisfató­rias, e o diretor de voo Carpenter estava feliz. O lançamento con­tinuava viável. As más condições de aterrissagem no aeroporto de Ben Guerir eram apenas uma preocupação menor, uma vez que os dois lugares de aterrissagem transatlânticas alternativos na Es­panha estavam operacionais. Aquilo, porém, era apenas precau­ção dobrada. Tais lugares só seriam necessários em caso de uma grave avaria.

Olhou ao redor para o resto da equipe de lançamento para ver se havia alguma nova preocupação. A tensão nervosa na sala de controle da missão era perceptível e crescente, como sempre cos­tumava ser antes de um lançamento, e aquilo era bom. No dia em que não estavam tensos, cometeram erros. Carpenter queria o seu pessoal no limite, com todas as sinapses a postos — um nível de atenção que, à meia-noite, requeria uma dose extra de adrenalina.

Os nervos de Carpenter estavam tão tensos quanto os de todo mundo, apesar da contagem regressiva continuar no horário. A equipe de inspeção no Centro Espacial Kennedy terminara a sua verificação. A equipe de dinâmica de vôo havia reconfirmado a hora de lançamento. Enquanto isso, um extenso grupo de milha­res de pessoas espalhadas por todo o mundo acompanhava a mesma contagem regressiva.

No Cabo Canaveral, onde o ônibus espacial estava posicionado para o lançamento, a mesma tensão se acumulava na sala de pro­pulsão no Centro de Controle de Lançamento, onde uma equipe estava sentada diante de seus consoles, preparando a decolagem. Assim que os foguetes de combustível sólido fossem acionados, o Controle da Missão em Houston assumiria. Embora a milhares de quilômetros uma da outra, as duas salas de controle em Houston e no Cabo Canaveral estavam tão intimamente interligadas que bem podiam estar localizadas no mesmo prédio.

Em Huntsville, Alabama, no Centro Marshall de Vôo Espacial, equipes de pesquisadores esperavam que suas experiências fossem lançados.

A 250 quilômetros ao norte-nordeste do Cabo Canaveral, navios da marinha esperavam para recuperar os foguetes de com­bustível sólido, que se separariam do ônibus espacial após se es­gotarem.

Em locais de aterrissagem de emergência e em estações de rastreamento do mundo inteiro, do NORAD, no Colorado, ao campo de pouso internacional de Banjul, na Gâmbia, homens e mulheres estavam de olho na contagem regressiva.

E, neste momento, sete pessoas estão se preparando para entre­gar a própria vida em nossas mãos.

Carpenter podia ver os astronautas agora, em circuito fecha­do de TV, enquanto eram ajudados a vestir os trajes laranja de lançamento e reentrada. As imagens vinham ao vivo da Flórida, mas sem áudio. Carpenter parou um instante para examinar os seus rostos. Embora nenhum deles revelasse qualquer vestígio de medo, ele sabia que o sentiam por trás de suas expressões radian­tes. O pulso acelerado, a vibração do nervosismo. Eles conheciam os riscos e tinham de estar amedrontados. Vê-los na tela era uma forte lembrança para o pessoal de terra de que sete seres humanos esperavam que fizessem direito o seu trabalho.

Carpenter tirou os olhos do monitor de vídeo e voltou a concentrar a atenção em sua equipe de controladores de vôo, sentados em 16 consoles. Embora conhecesse cada membro da equipe pelo nome, dirigia-se a eles por suas tarefas no comando da missão, seus títulos reduzidos às abreviações do jargão da NASA: o encarregado da orientação era apelidado de GDO, o encarregado da comunicação com a espaçonave era chamado Capcom, o engenheiro de sistemas de propulsão, de Prop, e o cirurgião de vôo de Cirurgião. O próprio Carpenter era conhecido como Vôo.

A contagem regressiva chegou a "t" menos três horas. A missão continuava confirmada.

Carpenter enfiou as mãos nos bolsos e balançou o chaveiro em forma de trevo. Era seu ritual particular de boa sorte. Até mesmo os engenheiros tinham as suas superstições.

Que nada dê errado, pensou. Não no meu turno.

Cabo Canaveral

O passeio de Astrovan do prédio de Operações e Partidas para a plataforma de lançamento 39B demorou 15 minutos. Foi um passeio estranhamente silencioso, ninguém da tripulação querendo dizer muita coisa. Apenas meia hora antes, enquanto se vestiam, brincavam e riam naquele tom agudo e elétrico caracte­rístico de quem está com os nervos à flor da pele. A tensão come­çara a aumentar no momento em que despertaram, às 2h30, para fazer o tradicional desjejum de filé com ovos. Durante o boletim meteorológico, no tempo que levou para vestirem os trajes, e no ritual de pré-lançamento — distribuir cartas de jogo e ver quem tinha a melhor mão de pôquer — todos estavam muito baru­lhentos e alegres, todos irradiando confiança.

Agora, estavam em silêncio.

A van parou. Chenoweth, o novato, sentado ao lado de Emma, murmurou:

—Nunca achei que assadura de fralda fosse um dos riscos da profissão.

Ela teve de rir. Todos usavam fraldas geriátricas sob seus volumosos trajes de vôo. Demorariam três longas horas até a decolagem.

Com a ajuda dos técnicos da plataforma de lançamento, Emma saiu da van. Durante um instante, fez uma pausa ao pé da plataforma, olhando maravilhada para o ônibus espacial de trinta andares iluminado pelos refletores. Na última vez que visitara a plataforma, havia cinco dias, os únicos sons que ouviu foram o do vento marinho e dos pássaros. Agora, a própria espaçonave ganhava vida, roncando e fumegando como um dragão que des­pertava, enquanto os propelentes voláteis ferviam no interior do tanque de combustível.

Foram de elevador até o Nível 195 e saíram no passadiço gradeado. Ainda era noite, mas o céu estava inundado pelas luzes da plataforma, e ela mal podia ver o brilho das estrelas. A escuridão do espaço a esperava.

Na sala esterilizada, técnicos vestindo roupas de uma só peça, que os faziam parecer coelhos, ajudaram cada membro da tripulação a atravessar a escotilha e ingressar no veículo orbital. O comandante e o piloto sentaram-se primeiro. Emma, que fica­ria na cabine intermediária, foi a última a se sentar. Acomodou-se no assento acolchoado, cintos de segurança apertados, capa­cete no lugar e polegar erguido.

A escotilha se fechou, isolando a tripulação do exterior.

Mesmo com as vozes ar-terra tagarelando em seus fones de ouvido e com os gorgolhares e gemidos do ônibus espacial que despertava, as batidas ritmadas de seu próprio coração ainda eram audíveis. Como passageira da cabine intermediária, pouco teria a fazer nas próximas duas horas, a não ser ficar sentada, pen­sando. As verificações de pré-lançamento seriam feitas pela tri­pulação. Não tinha vista do exterior, nada para olhar além da área de carga e da despensa de comida.

Lá fora, a manhã logo iluminaria o céu, e os pelicanos sobrevoariam as ondas de Playalinda Beach.

Ela inspirou profundamente e se recostou na cadeira para esperar.

Sentado na praia, Jack observou o nascer do sol.

Não estava só em Jetty Park. Os observadores começaram a se reunir ali bem antes da meia-noite, os carros formando uma fila interminável de faróis ocupando a via expressa Bee Line, alguns indo para o norte, em direção ao santuário de vida selvagem de Merritt Island, outros atravessando o rio Banana em direção à cidade de Cabo Canaveral. A vista seria boa nos dois locais. A multidão ao seu redor estava com espírito de férias, portando toalhas de praia e cestas de piquenique. Ouviu risadas, rádios ba­rulhentos e o choro de crianças sonolentas. Cercado por esse re­demoinho de gente festiva, ele era uma presença solitária, um homem a sós com seus pensamentos e seus medos.

Quando o sol iluminou o horizonte, ele olhou para o norte, em direção à plataforma de lançamento. Ela estaria a bordo da Atlantis agora, esperando, amarrada ao assento. Excitada, feliz e um tanto temerosa.

Jack ouviu uma criança dizer:

—Ele é um homem mau, mamãe.

Ele se voltou e viu uma menina. Ambos se olharam um instante, uma pequena princesa loura encarando um homem com roupas amarrotadas e barba por fazer. A mãe tomou a menina nos braços e rapidamente se mudou para um lugar mais seguro na praia.

Jack balançou a cabeça, divertido, e voltou a olhar para o norte. Para Emma.

 

Houston

A Sala de Controle de Vôo estava enganadoramente silenciosa. Faltavam vinte minutos para o lançamento, hora de verificar se a missão ainda estava confirmada. Todos os controladores da sala dos fundos haviam completado a verificação de seus sistemas e agora a sala da frente estava pronta para ser acionada.

Com a voz calma, Carpenter leu a lista, requisitando confirmação verbal de cada um dos controladores da sala da frente.

—FDO? — perguntou Carpenter.

—FDO pronto — respondeu o diretor de dinâmica de vôo.

—GDO?

—Orientação pronta.

—Cirurgião?

—Cirurgião pronto.

—DPS?

—Processamento de dados pronto.

Ao consultar a todos e receber respostas afirmativas, Carpenter meneou a cabeça vigorosamente para todos na sala.

Houston, estão prontos? — perguntou o diretor de lançamento em Cabo Canaveral.

—Controle da missão pronto — confirmou Carpenter.

A mensagem tradicional do diretor de lançamento para a tripulação do ônibus espacial foi ouvida por todos no Controle da Missão, em Houston.

—Atlantis, lançamento confirmado. Em nome de todos nós em Cabo Canaveral, desejo-lhes sucesso e boa sorte.

—Controle de Lançamento, aqui é a Atlantis — foi a respos­ta do comandante Vance. — Obrigado por terem preparado este pássaro para voar.

 

Cabo Canaveral

Emma fechou e travou o visor, acionando o fornecimento de oxi­gênio. Dois minutos para o lançamento. Encasulada e isolada em seu traje, nada mais tinha a fazer a não ser contar os segundos. Ela sentiu o estremecer dos motores principais, ajustando-se para a posição de lançamento.

"T" menos trinta segundos. A ligação elétrica com o controle em terra estava cortada, e os computadores de bordo assumiram o controle.

Seu coração acelerou, a adrenalina invadindo suas veias. Ao ouvir a contagem regressiva, ela já sabia, segundo por segundo, o que esperar, conseguia ver em sua mente a sequência de even­tos que agora se desenrolavam.

Em "t" menos oito segundos, milhares de litros de água se­riam derramados sob a plataforma para abafar o rugido dos motores.

Em "t" menos cinco, os computadores de bordo abririam as válvulas para permitir que o oxigênio e o hidrogênio líquido ti­vessem acesso aos motores principais.

Ela sentiu a nave dar uma guinada para o lado quando os três motores principais entraram em ignição, a espaçonave forçando os parafusos que ainda a prendiam à plataforma de lançamento.

Quatro. Três. Dois... O ponto sem retorno.

Ela prendeu a respiração, mãos apertadas com força, quando os foguetes de combustível sólido entraram em ignição. A turbulência era de fazer tremer os ossos, o rugido tão doloroso que ela mal conseguia escutar as comunicações nos fones de ouvido. Teve de trincar os dentes para evitar que se chocassem uns contra os outros. O ônibus espacial traçava a sua planejada trajetória em arco sobre o Atlântico, e ela sentia o corpo esmagado contra a poltrona pela aceleração, que chegava a 3g. Seus membros esta­vam tão pesados que mal conseguia movê-los, as vibrações tão violentas que parecia que o veículo orbital certamente se esface­laria em pedaços. Estavam em Max Q, o pico da turbulência, e o comandante Vance anunciou estar reduzindo a potência dos mo­tores principais. Em menos de um minuto, voltariam à potência máxima.

À medida que os segundos passavam, enquanto o capacete chocalhava ao redor de sua cabeça e a força do lançamento aper­tava o seu peito como uma mão implacável, ela sentiu uma pon­tada de apreensão. Fora neste ponto do lançamento que a Challenger explodira.

Emma fechou os olhos e lembrou-se da simulação com Hazel havia duas semanas. Agora, estavam se aproximando do ponto em que tudo na simulação começara a dar errado, quando foram for­çados a um cancelamento RTLS e Kittredge perdera o controle do veículo orbital. Aquele era um momento crítico do lançamento, e não havia nada que ela pudesse fazer, a não ser ficar sentada e es­perar que a vida real fosse mais clemente que a simulação.

Nos fones de ouvido, ouviu Vance dizer:

—Controle, aqui é a Atlantis. Aumentando a potência.

—Entendido, Atlantis. Aumente.

Jack olhava fixamente para cima, coração na garganta, enquan­to o ônibus espacial erguia-se no céu. Ouviu o estalar dos fo­guetes de combustível sólido quando começaram a cuspir finas línguas de fogo. A trilha de fumaça subia cada vez mais alto, encimada por um pontinho brilhante que era o ônibus espacial. Ao seu redor, a multidão irrompia em aplausos. Um lançamen­to perfeito, pensavam todos. Mas Jack sabia que havia muitas coisas que ainda podiam dar errado.

Subitamente, entrou em pânico por ter perdido a noção do tempo. Quantos segundos haviam transcorrido? Teriam passado de Max Q? Protegeu os olhos contra o sol da manhã, tentando ver a Atlantis, mas só conseguia ver a trilha de fumaça.

A multidão já começava a voltar para seus carros.

Permaneceu imóvel onde estava, apreensivo. Não viu nenhuma explosão terrível. Nenhuma fumaça negra. Nenhum pesadelo.

A Atlantis escapara da Terra em segurança e agora cruzava o espaço.

Sentiu lágrimas escorrerem pelo seu rosto, mas não se incomodou em enxugá-las. Deixou-as cair enquanto continuava a olhar para cima, para a trilha de fumaça que se dissipava, mar­cando a ascensão de sua mulher aos céus.

 

A Estação

25 de julho

Beatty, Nevada

Sullivan Obie despertou com um gemido ao ouvir o telefone tocar. Ouvia sinos badalando dentro de sua cabeça e sentia na boca um gosto de cinzeiro usado. Estendeu a mão para pegar o telefone e acidentalmente derrubou-o no chão. O baque o fez estremecer de dor. Ah, esqueça, pensou, e virou-se de lado, enfiando o rosto em um tufo de cabelos emaranhados.

Uma mulher?

Forçando a vista contra o sol da manhã, ele confirmou que, de fato, havia uma mulher deitada na cama ao seu lado. Uma loura. Roncando. Ele fechou os olhos, esperando que, caso vol­tasse a dormir, ela já tivesse ido embora quando despertasse ou­tra vez.

Mas ele não podia dormir agora. Não com uma voz berrando no aparelho caído.

Apalpou ao redor da cama e encontrou o telefone.

—O que foi, Bridget? — disse ele. — O quê?

—Por que não está aqui? — perguntou Bridget.

—Porque estou dormindo.

—São 10h30! Alôu? Reunião com os novos investidores? Também devo adverti-lo que Cásper está em dúvida entre cruci­ficá-lo ou estrangulá-lo.

Os investidores. Merda.

Sullivan sentou-se na cama e levou as mãos à cabeça, esperando passar a tontura.

—Olhe, apenas largue essa piranha e venha logo para cá — disse Bridget. Casper já os está levando para o hangar.

—Dez minutos — disse ele.

Ele desligou e se levantou.

A piranha não se mexeu. Ele não fazia ideia de quem era, mas deixou-a dormindo na cama, dando-se conta de que nada tinha que valesse a pena ser roubado.

Não havia tempo para tomar banho e fazer a barba. Pegou três aspirinas, engoliu-as com uma xícara de café forte e se foi em cima de sua Harley.

Bridget o esperava do lado de fora do hangar. Parecia mes­mo uma legítima Bridget irlandesa: corpulenta, ruiva e mal-humorada.

Às vezes, infelizmente, os estereótipos se mostram verdadeiros.

—Estão para ir embora — sussurrou entre dentes. — Vá até eles.

—Quem são mesmo esses caras?

—Certos Srs. Lucas e Rashad. Representam um consórcio de 12 investidores. Perca esta oportunidade, Sully, e estamos fritos. — Ela fez uma pausa, olhando para ele com desagrado. — Ah, droga, já estamos fritos. Olhe para você. Não podia ao menos ter se barbeado?

—Quer que eu volte em casa? Posso alugar um smoking no caminho.

—Esqueça.

Entregou-lhe um jornal dobrado.

—O que é isso?

Casper quer isso aí. Entregue para ele. Agora, vá até lá e convença-os a assinar o cheque. Um cheque gordo.

Suspirando, ele entrou no hangar.

Diante do brilho abrasivo do deserto, a relativa escuridão revelou-se um conforto para seus olhos. Demorou um instante até ver os três homens, de pé, junto à barreira térmica de ladrilhos negros do veículo orbital Apogee II. Os dois visitantes, ambos ves­tindo ternos executivos, pareciam deslocados em meio a todas aquelas ferramentas e equipamento aeronáutico.

—Bom dia, senhores! — exclamou. — Desculpem o atraso, mas fiquei preso em uma teleconferência. Vocês sabem como es­sas coisas podem demorar...—Ele olhou para Casper Mulholland, que o encarava com uma expressão que dizia não force a barra, seu babaca, e engoliu em seco. — Sou Sullivan Obie — disse ele. — Sócio do Sr. Mulholland.

—O Sr. Obie conhece cada porca e parafuso deste RLV — disse Casper. — Trabalhava com o velho mestre Bob Truax, na Califórnia. Na verdade, ele pode explicar o sistema melhor do que eu. Por aqui, nós o chamamos de nosso Obie-Wan.

Os dois visitantes simplesmente piscaram. O fato de o idioma universal de Guerra nas estrelas não conseguir extrair-lhes um sorriso de simpatia era um mau sinal.

Sullivan cumprimentou Lucas, depois Rashad, o sorriso se alargando enquanto suas esperanças esmoreciam. Ao mesmo tempo, sentia um ressentimento crescente contra aqueles dois ca­valheiros bem-vestidos cujo dinheiro ele e Casper precisavam tão desesperadamente. O Apogee Engineering, seu bebê, o sonho que nutriram nos últimos 13 anos, estava a ponto de falir, e apenas uma injeção de capital de um novo grupo de investidores poderia salvá-los. Ele e Casper teriam de fazer o melhor discurso de ven­das de suas vidas. Se aquilo não funcionasse, podiam guardar as ferramentas e vender o veículo orbital como carro alegórico.

Com um floreio, Sullivan estendeu o braço em direção ao Apogee II, que mais parecia um hidrante com janelas do que um avião-foguete.

—Sei que não parece ser grande coisa — disse ele. — Mas o que construímos aqui é o veículo de lançamento reutilizável mais econômico e prático que existe atualmente. Usa um sistema de lançamento SSTO assistido. Após a decolagem vertical, após su­bir 12 quilômetros, foguetes de pressão aceleram o veículo a uma velocidade de Mach 4 com pressões de baixa dinâmica. Este veí­culo orbital é inteiramente reutilizável e pesa apenas 8,5 tonela­das. Preenche os princípios que acreditamos que sejam o futuro da viagem espacial comercial. Menor. Mais rápido. Mais barato.

—Utiliza que tipo de motores de ascensão? — perguntou Rashad.

—Motores Rybinsk RD-38 a ar, importados da Rússia.

- Por que da Rússia?

- Porque, Sr. Rashad, cá entre nós, os russos sabem mais de foguetes do que qualquer outro povo na Terra. Desenvolveram dezenas de motores de foguetes de combustível líquido, usando materiais sofisticados que podem operar em altas pressões. Nosso país, lamento dizer, desenvolveu apenas um novo motor de com­bustível líquido desde a Apollo. Esta é agora uma indústria inter­nacional. Escolhemos os melhores componentes para nosso pro­duto, venham de onde vierem.

- E como essa... coisa aterrissa? — perguntou o Sr. Lucas, olhando com dubiedade para o veículo orbital em forma de hidrante.

—Bem, esta é a beleza do Apogee II. Como perceberão, a nave não tem asas. Não precisa de uma pista de pouso. Em vez disso, cai em linha reta, usando paraquedas para desacelerar e airbags para acolchoarem o impacto com a terra. Pode aterrissar em qualquer lugar, até mesmo no mar. Outra vez temos de tirar o chapéu para os russos, porque copiamos deles algumas caracte­rísticas de sua antiga cápsula Soyuz, que foi seu burro de carga mais confiável durante décadas.

—Vocês gostam dessa antiga tecnologia russa, hein? — perguntou Lucas.

Sullivan se empertigou.

—Gosto de tecnologia que funciona. Digam o que quiserem sobre os russos, mas eles sabem o que estão fazendo.

— Então o que você tem aqui é algo híbrido — disse Lucas. —Uma Soyuz misturada com um ônibus espacial.

—Um ônibus espacial bem pequeno. Gastamos 13 anos de pesquisa e apenas 65 milhões de dólares para chegar tão longe. Isso é incrivelmente barato se comparado ao que custou o ônibus espacial. Com várias espaçonaves, acreditamos que conseguirão um retorno anual de 30 por cento do investimento, caso haja 1.200 lançamentos por ano. O custo por voo seria de 80 mil dóla­res. O preço por quilo sairia pela bagatela de 270 dólares. Menor, mais rápido, mais barato. Esse é o nosso mantra.

—Quão menor, Sr. Obie? Qual a sua capacidade de carga útil?

Sullivan hesitou. Aquele era o ponto no qual podia perdê-los.

—Podemos lançar em órbita baixa uma carga útil de 300 quilos, mais o piloto.

Houve um longo silêncio.

O Sr. Rashad disse:

—Isso é tudo?

—São quase 700 libras. Dá para carregar um bocado de material de pesquisa em...

—Sei quanto são 300 quilos. Não é muito.

—O que compensamos com lançamentos mais frequentes. Você quase pode pensar neste veículo orbital como um aeropla­no espacial.

—Na verdade... na verdade, já despertamos o interesse da NASA! — exclamou Cásper com um tom de desespero. — Este é o tipo de sistema que podem comprar para levar cargas leves para a estação espacial.

Lucas ergueu as sobrancelhas.

—A NASA está interessada?

—Bem, temos uma posição favorável na concorrência.

Merda, Casper, pensou Sullivan.Não vá por aí.

—Mostre-lhes o jornal, Sully.

—O quê?

— Los Angeles Times. Segunda página.

Sullivan olhou para o jornal que Bridget lhe entregara. Ele foi até a página dois e viu a matéria "NASA substitui astronauta". Ao lado, havia uma foto de altos dignitários do Centro Espacial Johnson em uma coletiva de imprensa. Ele reconheceu o sujeito feioso de orelhas grandes e cabelo mal cortado. Era Gordon Obie.

Casper pegou o jornal e mostrou-o aos visitantes.

—Vê este homem aqui, ao lado de Leroy Cornell? É o Diretor de Operações de Tripulação, o irmão do Sr. Obie.

Os dois visitantes, obviamente impressionados, voltaram-se e olharam para Sullivan.

—Bem? — disse Casper. — Os cavalheiros se importariam em falar de negócios?

—Podemos adiantar o seguinte — disse Lucas. — O Sr. Rashad e eu já demos uma olhada no que outras empresas aero­espaciais estão desenvolvendo. Estivemos na Kelly Astroliner, Roton e Kistler K-l. Ficamos impressionados com todas, espe­cialmente com a K-l. Mas achamos que deveríamos dar uma chance para a sua pequena empresa.

Sua pequena empresa.

Foda-se, pensou Sullivan. Ele odiava pedir dinheiro, odiava ficar de joelhos diante de executivos. Aquilo era uma campanha perdida. Sua cabeça doía, seu estômago roncava, e aqueles dois almofadinhas o estavam fazendo perder tempo.

—Diga-nos por que devemos apostar no seu cavalo — disse Lucas. — O que torna o Apogee nossa melhor escolha?

— Francamente, cavalheiros, não creio que sejamos sua melhor escolha — respondeu Sullivan rispidamente. Então, deu- lhes as costas e se afastou.

—Hã... desculpem — disse Casper, e foi atrás do sócio.

Sully! — sussurrou. — O que diabos está fazendo?

—Esses caras não estão interessados em nós. Você os ouviu. Eles adoraram o K-l. Querem foguetes grandes. Iguais aos seus pintos.

—Não estrague tudo! Volte e fale com eles.

—Por quê? Eles não vão assinar cheque nenhum.

—Se os perdemos, perdemos tudo.

—Já perdemos.

—Não. Não, você pode vender isso para eles. Tudo o que tem a fazer é dizer-lhes a verdade. Dizer-lhes no que realmente acre­ditamos. Porque você e eu sabemos que temos o melhor veículo.

Sullivan esfregou os olhos. O efeito da aspirina estava passando e sua cabeça doía. Estava cansado de implorar. Ele era enge­nheiro e piloto e passaria tranquilamente o resto da vida sujando as mãos com graxa de motor. Mas aquilo não aconteceria, não sem novos investidores. Não sem dinheiro.

Ele deu meia-volta e voltou para falar com os visitantes. Para a sua surpresa, ambos pareciam olhá-lo com prudente respeito. Talvez porque lhes tivesse dito a verdade.

—Muito bem — disse Sullivan, fortalecido pelo fato de nada ter a perder. Tombaria como um homem. — Este é o acordo: podemos provar tudo o que dissemos com uma simples demons­tração. As outras empresas estão prontas para lançar os seus pro­tótipos? Não, não estão. Precisam de um tempo de preparação

desprezou. — Meses e meses. Já nós podemos lançar a qualquer hora. Tudo o que precisamos é posicionar esta belezinha em seu propulsor e poderemos lançá-la em órbita baixa. Droga, po­demos mandá-la entregar cachorros-quentes na estação espacial. Portanto, dê-nos uma data. Digam-nos quando querem que lan­cemos, e o faremos.

Casper ficou branco como... bem, um fantasma. Sullivan os lançara em um limbo tão distante que agora tentavam se agarrar ao nada. O Apogee II ainda não fora testado. Estivera naquele hangar por mais de 14 meses, acumulando poeira enquanto eles procuravam dinheiro. Agora Sully queria lançá-lo em órbita em uma viagem inaugural?

—De fato, estou tão confiante que a nave passará no teste

disse Sullivan, aumentando ainda mais a aposta —, que eu mesmo a pilotarei.

Casper levou a mão ao estômago.

—Ah... isso é apenas maneira de falar, senhores. A nave pode voar perfeitamente sem piloto e...

—Mas não há problema — disse Sullivan. — Deixem-me pilotá-la. Será mais interessante para todo mundo. O que dizem?

Digo que você está maluco, responderam-lhe os olhos de Casper.

Os dois executivos se entreolharam e cochicharam entre si. Então Lucas disse:

—Estamos muito interessados em uma demonstração. Vai demorar até conciliarmos os horários de viagem de todos os nos­sos sócios. Digamos... um mês. Podem fazê-lo?

O outro estava pagando para ver o seu blefe. Sullivan apenas sorriu.

—Um mês? Sem problema.

Ele olhou para Casper, que agora estava de olhos fechados, como se sentisse alguma dor.

—Nos falamos — disse Lucas, e voltou-se para a porta.

—Uma última pergunta, se me permite — disse o Sr. Rashad, apontando para o veículo orbital. — Percebi que o nome de seu protótipo é Apogee II. Houve um Apogee I?

Casper e Sullivan se entreolharam.

—Hã, sim — disse Casper. — Houve...

—O que aconteceu?

Casper se calou.

Que diabos, pensou Sullivan. A verdade parecia funcionar com aqueles caras. Não custava tentar outra vez.

—Caiu e pegou fogo — disse ele antes de sair do hangar.

Caiu e pegou fogo. Este era o único meio de descrever o que acontecera naquela manhã fria e clara, havia um ano e meio. A manhã em que seus sonhos também caíram e pegaram fogo. Sen­tado na surrada escrivaninha de seu escritório na empresa, cui­dando da ressaca com uma xícara de café, não conseguia evitar reviver cada detalhe doloroso daquele dia. Todas as autoridades da NASA reunidas no local de lançamento. Seu irmão, Gordie, sorridente e orgulhoso. O ar de celebração entre os 12 emprega­dos do projeto Apogee e o grupo de investidores que se reuniram na tenda para os donuts e para o café de pré-lançamento.

A contagem regressiva. A decolagem. Todos olhando para cima enquanto o Apogee I subia transformando-se em um ponti­nho brilhante no céu.

Então, um clarão. E estava tudo acabado.

Seu irmão não dissera muito, apenas algumas palavras de consolo. Mas assim era Gordon. Durante toda a sua vida, sempre que Sullivan se ferrava — o que parecia acontecer com frequên­cia Gordon apenas balançava a cabeça em pesar. Gordon era o irmão mais velho, o irmão sóbrio e confiável que se distinguira como comandante de ônibus espacial.

Sullivan sequer chegara a ingressar no corpo de astronautas. Embora também fosse piloto e engenheiro aero-espacial, as coisas nunca pareciam favorecê-lo. Se entrasse em uma cabine, esse seria o exato momento em que um fio entraria em curto ou se rompe­ria. Sempre achou que as palavras não fui eu deviam ser tatuadas na sua testa, porque frequentemente não era sua culpa o fato das coisas darem errado. Mas Gordon não via assim. As coisas nunca davam errado para ele. Gordon achava que o conceito de má sorte era uma desculpa para acobertar incompetência.

- Por que não liga para ele?

Sullivan ergueu a cabeça. Bridget estava em pé ao lado de sua escrivaninha, os braços cruzados como uma professora zangada.

—Para quem?

—Para o seu irmão, quem mais? Diga-lhe que lançaremos o segundo protótipo. Convide-o para assistir. Talvez traga o resto da NASA.

—Não quero nada da NASA.

Sully, se nós os impressionarmos, damos um jeito nesta empresa.

—Como da última vez, não é mesmo?

—Aquilo foi azar. Resolvemos o problema.

—Então, talvez, aconteça outro infortúnio.

—Você está nos agourando, sabia? — Ela empurrou o telefone em sua direção. — Ligue para o Gordon. Se vamos rolar os dados, devemos apostar a casa.

Ele olhou para o telefone, pensando no Apogee I. Em como uma vida de sonhos podia se vaporizar em um instante.

—Sully?

- Esqueça — disse ele. — Meu irmão tem mais o que fazer do que andar ao lado de fracassados.

Então, jogou o jornal na lata de lixo.

 

26 de julho

A bordo da Atlantis

— Ei, Watson — disse o comandante Vance em direção à cabi­ne intermediária. — Suba até aqui e dê uma olhada em seu novo lar.

Emma flutuou escada acima e emergiu na cabine de coman­do, bem atrás do assento de Vance. Ao olhar pela janela, inspirou profundamente, impressionada. Nunca estivera tão perto da es­tação. Durante a sua primeira missão, havia dois anos e meio, não acoplaram na ISS, apenas a observaram a distância.

—Linda, não é mesmo? — perguntou Vance.

—Ela é a coisa mais bonita que já vi — disse Emma em voz baixa.

E era mesmo. Com seus enormes painéis solares despontan­do da imensa estrutura principal, a ISS parecia um veleiro majestoso atravessando o céu. Construída por 16 países, seus compo­nentes foram enviados ao espaço em 45 lançamentos diferentes. Demoraram cinco anos para montá-la, peça por peça, em órbita. Longe de ser apenas uma maravilha da engenharia, era um sím­bolo do que o homem pode obter quando baixa suas armas e volta os olhos para o céu.

—Que apartamento espetacular! — disse Vance. — Isso é que é vista!

—Estamos na barra R — disse o piloto do ônibus espacial DeWitt. — Belo vôo.

Vance deixou o assento e posicionou-se à janela do teto da cabine de comando para a aproximação visual do módulo de acoplagem da ISS. Aquela era a fase mais delicada do complicado processo de encontro. A Atlantis fora lançada em uma órbita mais baixa do que a da ISS e, nos últimos dois dias, brincava de pega-pega com a estação espacial. Eles se aproximariam por baixo, usando seus jatos RCS para corrigirem o posicionamento durante a acoplagem. Emma ouviu o ruído dos propulsores e sentiu o veículo orbital estremecer.

—Veja — disse DeWitt. — Há um painel solar que foi atingido no mês passado.

Ele apontou para um dos painéis solares marcado por um buraco. Um dos perigos inescapáveis do espaço é a constante chuva de meteoritos e detritos produzidos pelo homem. Até mes­mo um pequeno fragmento pode ser um míssil devastador via­jando a milhares de quilômetros por hora.

Ao se aproximarem, a estação preencheu a vista, e Emma sentiu uma tal reverência e orgulho que seus olhos subitamente se encheram de lágrimas. Estou indo para casa, pensou.

A escotilha da câmara de ar se abriu e um rosto largo e marrom sorriu-lhes do outro lado do corredor que ligava a Atlantis à ISS.

—Trouxeram laranjas! — gritou Luther Ames para os cole­gas da estação, — Posso sentir o cheiro!

—Serviço de entrega domiciliar da NASA — disse o comandante Vance. — Suas compras chegaram.

Carregando um saco de náilon repleto de frutas frescas, Van­ce foi da Atlantis até a estação espacial.

Fora uma acoplagem perfeita. Com ambas as espaçonaves viajando a uma velocidade de quase 30 mil quilômetros por hora sobre a Terra, Vance se aproximara da ISS à delicada razão de 15 centímetros por segundo, alinhando com perfeição a Atlantis ao módulo de acoplagem da ISS,

Agora as escotilhas estavam abertas e os tripulantes da Atlantis flutuaram um por um para dentro da estação espacial, para serem recebidos com abraços, apertos de mão e os sorrisos de boas-vindas de gente que não via um rosto diferente havia meses.

O nodo era pequeno demais para abrigar 13 pessoas, e as tripula­ções rapidamente se espalharam pelos módulos adjacentes.

Emma, a quinta a entrar na estação, atravessou o corredor e inalou uma mistura de aromas, o odor ligeiramente azedo de corpos humanos confinados durante muito tempo em um lugar fechado. Luther Ames, um velho amigo que conhecera no treina­mento de astronautas, foi o primeiro a saudá-la.

—Dra. Watson, eu presumo! — exclamou, puxando-a para abraçá-la. — Bem-vinda a bordo. Quanto mais damas, melhor.

—Ei, você sabe que não sou uma dama.

Ele piscou.

—Vamos manter isso entre nós.

Luther estava sempre de bem com a vida, um homem cujo bom humor podia contagiar o ambiente. Todos gostavam de Lu­ther porque Luther gostava de todos. Emma estava feliz por ele estar a bordo.

Especialmente ao olhar para os outros colegas de estação. Primeiro, cumprimentou Michael Griggs, o comandante da ISS, e achou sua réplica educada, embora um tanto militar. Diana Es­tes, uma inglesa enviada pela Agência Espacial Européia, foi mui­to mais cordial. Ela sorriu, mas seus olhos eram de um azul estra­nho e glacial. Frio e distante.

A seguir, Emma voltou-se para o russo, Nicolai Rudenko, que estava havia mais tempo a bordo da ISS, quase cinco meses. As luzes do módulo pareciam ter lavado todas as cores de seu rosto, tornando-o tão cinzento quanto sua barba por fazer. Ao apertarem as mãos, ele mal a olhou nos olhos. Esse homem precisa ir para casa, pensou ela. Está deprimido. Exausto.

Kenichi Hirai, o astronauta da NASDA, flutuou em sua direção para cumprimentá-la. Este ao menos sorria e tinha um aperto de mão firme. Gaguejou uma saudação e rapidamente se retirou.

Àquela altura o módulo estava quase vazio, o resto dos tripulantes espalhando-se pela estação. Foi quando se viu sozinha com Bill Haning.

Debbie Haning morrera havia três dias. A Atlantis levaria Bill para casa, mas não para a beira do leito hospitalar e, sim, para o funeral de sua mulher.

Emma flutuou em sua direção.

—Sinto muito — murmurou. — Mesmo.

Ele simplesmente meneou a cabeça e desviou o olhar.

—É estranho — disse Bill. — Achávamos que, se algo tivesse de acontecer, seria comigo, porque sou o grande herói da família. Aquele que assume todos os riscos. Nunca nos ocorreu que seria ela...

Ele inspirou profundamente. Emma viu que Bill lutava para manter a compostura e sabia que aquela não era hora para pala­vras de consolo. Até mesmo um ligeiro toque poderia destruir o seu frágil controle emocional.

—Bem, Watson — disse ele afinal. — Acho que cabe a mim mostrar-lhe os procedimentos, uma vez que você veio para me substituir.

Ela assentiu.

—Quando estiver pronto, Bill.

—Que seja agora. Tenho muito a dizer. E não há muito tem­po para a troca.

Embora Emma estivesse familiarizada com a disposição da estação, sua primeira visão do interior da estrutura real foi uma experiência avassaladora. A falta de peso em órbita significava que não havia em cima ou embaixo, chão ou teto. Toda a super­fície constituía espaço de trabalho funcional e, caso ela se virasse muito rápido, instantaneamente perderia o senso de direção. Aquilo, somado à náusea, a obrigava a se mover lentamente, con­centrando os olhos em um único ponto ao se voltar.

Ela sabia que o núcleo da ISS tinha tanto espaço habitável quanto dois Boeing 747, mas todo esse espaço era distribuído en­tre uma dúzia de módulos do tamanho de ônibus, unidos por pontos de conexão chamados nodos, como em um jogo de mon­tar. O ônibus espacial acoplara no Nodo 2. Acoplado a este mes­mo nodo havia o laboratório da Agência Espacial Européia, e os laboratórios japonês e americano, que serviam como portais para o resto da estação.

Bill guiou-a para fora do laboratório dos EUA até o ponto de conexão seguinte, o Nodo 1. Ali, fizeram uma breve pausa para olharem pela cúpula de observação. A Terra rodava lentamente sob eles, nuvens leitosas rodopiando sobre os mares.

— E aqui que passo a maior parte de meus momentos de fol­ga — disse Bill. — Fico aqui, olhando através dessas janelas. São quase sagradas para mim. Chamo este lugar de Igreja da Mãe Terra. — Desviou o olhar e voltou-se para a escotilha do nodo seguinte. — No outro lado fica a escotilha de EVA — disse ele. — E a escotilha debaixo leva ao módulo habitacional. Você vai dormir ali. O CRV fica no outro extremo do módulo habitacio­nal, para facilitar o acesso em caso de evacuação.

—Neste módulo dormem três tripulantes?

Ele confirmou.

—Os outros três dormem no módulo de serviço russo. Fica depois daquela escotilha ali. Vamos até lá agora.

Deixaram o Nodo 1 e, como peixes nadando através de um labirinto de túneis, entraram na parte russa da estação.

Aquela era a parte mais antiga da ISS, a seção que estava em órbita havia mais tempo e que já dava mostras de sua idade. Ao passarem por Zarya — a unidade de energia e propulsão —, Emma viu manchas nas paredes, arranhões e mossas ocasionais. O que fora apenas um conjunto de cópias heliográficas em sua cabeça agora assumia textura e detalhes sensoriais. A estação era mais do que um labirinto de laboratórios brilhantes, era também um lar para seres humanos, e o desgaste provocado pelos ocu­pantes, ao longo do tempo, era evidente.

Entraram no módulo de serviço russo, e Emma foi confrontada com a desorientadora imagem de Griggs e Vance de cabeça para baixo. Ou sou eu que estou de cabeça para baixo?, pensou Emma, divertida com aquele mundo desordenado de falta de peso. Assim como o módulo habitacional americano, o RSM tinha uma cozi­nha, toalete e lugares para três membros da tripulação poderem dormir. Na extremidade oposta, viu outra escotilha.

—Aquilo vai dar na velha Soyuz?— perguntou.

Bill assentiu.

—Nós a usamos para armazenar lixo agora. E tudo o que podemos fazer com ela.

A cápsula Soyuz, que outrora servira como bote salva-vidas de emergência, estava agora obsoleta, com baterias esgotadas havia muito tempo.

Luther Ames enfiou a cabeça para dentro do RSM.

—Ei, pessoal, é hora do show! Todo mundo no centro de conferência com a mídia. A NASA quer que os contribuintes ve­jam nosso encontro internacional aqui em cima.

Bill lançou-lhe um olhar cansado.

—Somos como animais no zoológico. Todo dia temos de sorrir para as malditas câmeras.

Emma foi a última a se juntar aos outros no módulo habitacional. Quando chegou lá, uma dúzia de pessoas já estava ali reu­nida. Aquilo parecia um emaranhado de braços e pernas, todos flutuando, tentando não colidir uns contra os outros.

Enquanto Griggs se esforçava para organizar tudo, Emma esperou no Nodo 1. Flutuando, sentiu-se ir lentamente em direção à cúpula. A vista daquelas janelas era de tirar o fôlego.

Lá embaixo, a Terra se estendia em toda a sua magnificência, uma faixa de estrelas coroando a suave curvatura do horizonte. Estavam entrando no lado escuro agora e, lá embaixo, viu pontos de referência familiares em meio à escuridão. Houston. Era sua primeira passagem noturna.

Ela se aproximou da janela, pressionando a mão contra o vidro.Oh, Jack, pensou. Gostaria que estivesse aqui. Queria que você pudesse ver isso.

Então ela acenou. E teve certeza, sem a menor dúvida, de que em algum lugar na escuridão mais abaixo, Jack estava acenando de volta.

 

28 de julho

E-mail pessoal para: Dra. Emma Watson (ISS)

De: Jack McCallum

Como um diamante no céu. E assim que eu a vejo daqui. Na noite passada, fiquei acordado para vê-la passar. Acenei com von­tade.

Esta manhã, na CNN, você foi chamada de Sra. Eleita. "Jovem astronauta é lançada ao espaço e não rói sequer uma unha", ou algo tão superficial quanto. Entrevistaram Woody Ellis e Leroy Cornell, e ambos estavam orgulhosos como papais corujas. Para­béns. Você é a namoradinha da América.

Vance e a tripulação fizeram uma aterrissagem perfeita. Repórteres sanguessugas cercaram o pobre Bill quando ele chegou em Houston. Eu o vi de relance na TV: parece estar vinte anos mais velho. O funeral de Debbie será esta tarde. Comparecerei.

Amanhã, estarei navegando no golfo do México.

Bem, hoje eu recebi os documentos do divórcio e vou ser honesto com você: não gostei nem um pouco do que li. Mas acho que não é algo de que se deva gostar, não é mesmo?

De qualquer modo, estão prontos para serem assinados. Agora que finalmente acabou, talvez possamos voltar a ser ami­gos. Como costumávamos ser.

Jack

P.S.: Humphrey é uma peste. Você me deve um sofá novo.

 

E-mail pessoal para: Jack McCallum

De: Emma Watson

Namoradinha da América? Por favor! Aquilo não passou de uma cena de ação, com todos na Terra esperando eu me ferrar. Quando isso acontecesse, eu seria o espécime devíamos-ter-mandado-um-homem número I. Odeio isso.

Por outro lado, adoro estar aqui em cima. Como gostaria que você visse esta paisagem! Quando olho para a Terra e vejo quão in­crivelmente bela ela é, desejo que as pessoas lá embaixo tomem juí­zo. Se pudessem ver quão pequena e frágil e solitária é a Terra, cer­cada por todo esse espaço negro, tomariam mais cuidado com ela.

(Oh, lá vai ela outra vez, toda chorosa por causa do planeta. Deviam ter mandado um homem.)

Fico feliz em anunciar que a náusea se foi. Posso flutuar de mó­dulo em módulo sem problemas. Ainda fico um pouco tonta quan­do inadvertidamente olho para a Terra pela janela, Acaba com meu sentido de direção e demoro alguns segundos até voltar a me orien­tar. Estou tentando manter o ritmo de exercícios, mas duas horas por dia é muito tempo, especialmente quando tenho tanto a fazer. Dezenas de experiências para monitorar, um zilhão de e-mails de Operações de Carga Útil, cada cientista exigindo prioridade máxima para seu projeto de estimação. Vou acabar pegando o jeito. Esta manhã, porém, estava tão cansada que dormi durante toda a música de despertar enviada por Houston. (E Luther me disse que nos bombardearam com a Cavalgada das Valquírias, de Wagner!)

Quanto ao fim do divórcio, também não gosto nem um pouco. Mas, Jack, ao menos tivemos sete bons anos juntos. E mais do que conseguiram muitos casais. Sei que deve estar ansioso para terminar logo com isso. Prometo assinar os documentos assim que voltar. Não pare de acenar.

Em

P.S.: Humphrey nunca ataca a minha mobília. O que faz você para aborrecê-lo?

 

Emma desligou e fechou o laptop. Responder e-mails pessoais era a última tarefa do dia. Estava ansiosa por notícias de casa, mas a menção que Jack fizera sobre o divórcio a incomodara. Então, ele está disposto a ir adiante, pensou. Ele está pronto para "ser ami­go" outra vez.

Quando se fechou no saco de dormir, estava furiosa com Jack, pela facilidade com que ele aceitara o fim de seu casamento. No início do divórcio, quando ainda tinham discussões sérias, sentia-se estranhamente confiante a cada grave desentendimen­to. Mas agora os conflitos haviam terminado, e Jack chegara ao estágio de tranquila aceitação. Sem dor, sem arrependimentos.

E aqui estou eu, ainda sentindo a sua falta. E eu me odeio por

isso.

Kenichi hesitou em despertá-la. Deteve-se do lado de fora da cor­tina de sua estação de sono, perguntando-se se deveria chamá-la outra vez. Era um assunto sem importância, e ele estava odiando ter de perturbá-la. Parecera tão cansada durante o jantar que che­gara a cochilar segurando o garfo. Sem a constante atração da gravidade, o corpo não se dobra quando você fica inconsciente, e a cabeça não tomba para a frente para despertá-lo. Há relatos dando conta de astronautas exaustos que adormeceram em meio aos reparos que executavam, ainda segurando as ferramentas.

Decidiu não despertá-la e voltou, sozinho, ao laboratório dos EUA.

Kenichi nunca precisara de mais de cinco horas de sono por noite e, enquanto os outros dormiam, ele frequentemente vagava pelo labirinto da estação espacial, verificando as diversas expe­riências. Inspecionando, explorando. Parecia que era apenas quando a tripulação humana dormia que a estação assumia sua resplandecente personalidade. Tornava-se um ser autônomo que murmurava e estalava, seus computadores dirigindo mil funções diferentes, comandos eletrônicos percorrendo seu sistema nervo­so de fios e circuitos. Enquanto flutuava através do labirinto de túneis, Kenichi pensou em todas as mãos humanas que trabalha­ram para moldar cada centímetro quadrado daquela estrutura. Os encarregados da eletrônica, do metal, os modeladores de plástico. Os vidraceiros. Por causa de seu trabalho, um filho de fazen­deiro nascido em uma aldeia nas montanhas do Japão flutuava agora 354 quilômetros acima da Terra.

Kenichi estava a bordo da estação havia um mês e continuava maravilhado com tudo.

Ele sabia que sua estadia ali seria limitada. Ele sabia o quanto o seu corpo estava pagando por tudo aquilo. Estava ciente da constante perda de cálcio dos ossos, do afrouxamento dos mús­culos, da diminuição do vigor das artérias e do coração, agora li­vres do desafio de bombear o sangue contra a gravidade. Cada momento a bordo da ISS era precioso, e ele não queria desperdi­çar um minuto sequer. Portanto, durante as horas de sono pro­gramadas, vagava pela estação detendo-se junto às janelas e visi­tava os animais no laboratório.

Foi assim que descobriu o rato morto.

Estava flutuando com as pernas duras e estendidas, a boca rosada escancarada. Outro dos machos. Era o quarto rato a mor­rer em 16 dias.

Ele verificou se o habitat estava funcionando de acordo, se os limites de temperatura predeterminados não haviam sido ultra­passados e se a taxa de fluxo de ar se mantinha dentro do padrão de 12 mudanças por hora. Por que estavam morrendo? Seria con­taminação da água ou da comida? Havia alguns meses, a estação perdera uma dúzia de seus ratos de laboratório quando produtos químicos tóxicos vazaram no reservatório de água do habitat dos animais.

O rato flutuava em um canto do viveiro. Os outros machos estavam aglomerados no outro extremo, um tanto enojados do corpo de seu companheiro de cela. Pareciam ansiosos para se afastarem dele, patas agarradas à tela da gaiola. Do outro lado da divisória de arame, as fêmeas também estavam aglomeradas em um canto. Todas, exceto uma. Esta se contorcia, rodando lenta­mente em pleno ar, as garras em espasmos semelhantes aos de uma convulsão.

Outro rato doente.

Enquanto observava, a fêmea emitiu o que pareceu ser um último e doloroso suspiro e subitamente relaxou.

As outras fêmeas se juntaram ainda mais, uma massa de pelos brancos que se contorcia, em pânico. Ele tinha de remover os corpos antes que o contágio — caso o fosse — se espalhasse para os outros ratos.

Adaptou a caixa de luvas ao habitat, calçou luvas de látex e introduziu as mãos no espaço. Primeiro, removeu o corpo do rato macho e o introduziu em um saco plástico. Então, abriu o viveiro das fêmeas e pegou o segundo cadáver. Ao removê-lo, viu de relance algo branco e peludo passar junto à sua mão.

Uma das fêmeas conseguira escapar e entrara na caixa de luvas.

Ele a agarrou em pleno ar e quase imediatamente a soltou ao sentir uma dor aguda. Ela conseguira mordê-lo através da luva.

Imediatamente, Kenichi retirou as mãos da caixa, arrancou as luvas e olhou para o dedo. Viu uma gota de sangue que, de tão inesperada, deixou-o nauseado. Ele fechou os olhos, tentando se controlar. Aquilo não era nada, apenas uma pequena mordida. A justa vingança dos ratos por todas aquelas agulhas que ele lhes espetara. Voltou a abrir os olhos, mas ainda sentia-se nauseado.

Preciso descansar, pensou.

Ele recapturou o rato que se debatia no ar e devolveu-o à gaiola. Então, removeu os dois corpos ensacados e colocou-os no refrigerador. No dia seguinte, cuidaria daquilo. No dia seguinte, quando se sentisse melhor.

 

30 de julho

—Este morreu hoje — disse Kenichi. — É o sexto.

Emma olhou para o habitat animal e franziu o cenho. Os animais estavam alojados em uma gaiola com divisória, os machos separados das fêmeas apenas por uma grade de arame. Compar­tilhavam o mesmo ar, a mesma comida. Do lado dos machos, um rato morto flutuava, imóvel, os membros estendidos e rígidos.

Os outros machos estavam aglomerados na extremidade oposta do compartimento, agarrando-se à tela como se estives­sem ansiosos para sair dali.

—Você perdeu seis ratos em 17 dias? — perguntou Emma.

—Cinco machos. Uma fêmea.

Emma observou os animais remanescentes em busca de si­nais de doença. Todos pareciam agitados, olhos limpos, sem muco nas narinas.

—Primeiro, tiramos o que está morto — disse ela. — De­pois, olhamos os outros mais de perto.

Usando a caixa de luvas, ela removeu o cadáver. Já estava rígido, as pernas duras, a coluna inflexível. A boca estava parcial­mente aberta, a ponta da língua cor-de-rosa para fora. Não era incomum animais de laboratório morrerem no espaço. Em um voo de ônibus espacial em 1998, houvera quase 100 por cento de mortalidade entre ratos recém-nascidos. A microgravidade é um ambiente estranho e hostil, e nem todas as espécies se adaptam bem em tais condições.

Antes do lançamento, os ratos eram examinados em busca de bactérias, fungos e vírus. Se aquilo era uma infecção, eles a ha­viam contraído a bordo da ISS.

Ela inseriu o rato morto em um saco plástico, trocou as luvas e pegou um dos ratos vivos do compartimento. Ele se debateu com vigor, sem demonstrar sinais de estar doente. A única coisa incomum era uma orelha mordida por seus colegas de cativeiro. Ela o virou para examinar a barriga e se surpreendeu.

—É uma fêmea — exclamou.

—O quê?

—Você tinha uma fêmea no compartimento dos machos.

Kenichi se aproximou para olhar os genitais do rato através da janela da caixa de luvas. Era evidente. Ele enrubesceu, envergonhado.

—Na noite passada, ela me mordeu — explicou. — Eu a devolvi ao viveiro apressadamente.

Emma sorriu-lhe com simpatia.

—Bem, o pior que pode acontecer é uma inesperada proliferação.

Kenichi calçou as luvas e inseriu as mãos no segundo par de luvas da caixa.

—Eu cometi o erro — disse ele. — Eu o conserto.

Juntos, examinaram o restante dos ratos no compartimento, mas não encontraram outros espécimes fora de lugar. Todos pa­reciam saudáveis.

— Isso é muito estranho — disse Emma. — Se estamos lidando com uma doença contagiosa, deveria haver alguma evidência de infecção.

Watson? — chamou uma voz pelo interfone do módulo.

—No laboratório, Griggs — respondeu Emma.

—Há um e-mail urgente para você, enviado por Cargas Úteis.

—Vou lê-lo agora mesmo. — Ela fechou o viveiro e disse para Kenichi. — Preciso verificar essa mensagem. Por que não pega os ratos mortos que você guardou na geladeira? Vamos dar uma olhada neles.

Ele assentiu e flutuou em direção à geladeira. Diante do console do computador, Emma abriu o e-mail ur­gente.

 

Para: Dra. Emma Watson

De: Helen Koenig, Pesquisadora Principal

Re: Experimento CUC#23 (Cultura de Células Archaeon)

Mensagem: Cancele imediatamente a experiência. Os últimos espé­cimes trazidos pela Atlantis demonstram contaminação por fungos. Todas as culturas Archaeon, além de seus recipientes, devem ser incinerados no cadinho de bordo e as cinzas ejetadas da estação.

 

Emma leu e releu a mensagem na tela. Nunca antes recebera um pedido tão estranho. Uma contaminação por fungos não era algo perigoso. Incinerar as culturas pareceu-lhe uma solução muito drástica. Estava tão preocupada com aquele pedido intrigante que nem prestou atenção em Kenichi, que tirava os ratos mortos da geladeira. Só se virou quando ouviu sua exclamação espantada.

A princípio, viu apenas o rosto apavorado do colega, manchado por uma gosma asquerosa de entranhas. Então, olhou para o saco plástico que acabara de se romper. Em seu horror, ele o largara e aquilo flutuava livremente, pairando no ar entre eles. — O que é isso? — exclamou Emma. — O rato — disse ele, incrédulo.

Mas o que ela viu não era um rato morto e, sim, uma massa de tecido desintegrado, uma massa gosmenta e putrefeita de carne e pelos que vazava de dentro do saco em glóbulos fedorentos. Risco patogênico!

Ela atravessou o módulo rapidamente em direção ao painel de advertência e alarme e acionou o botão que interrompia o fluxo de ar entre os módulos.

Kenichi tirou duas máscaras com filtros de ar do armário de emergência. Atirou uma para Emma, que a usou para proteger o nariz e a boca. Não precisaram trocar palavras. Ambos sabiam o que devia ser feito.

Rapidamente, fecharam as escotilhas de ambas as extremidades do módulo, efetivamente isolando o laboratório do resto da estação. Então, Emma pegou cuidadosamente o saco de isola­mento biológico e aproximou-se do saco flutuante de carne li­quefeita. A tensão superficial unira o líquido em um único glóbu­lo, e se ela fosse cuidadosa o bastante para não agitar o ar, poderia capturá-lo integralmente na bolsa. Calmamente baixou a bolsa sobre o espécime flutuante e rapidamente o capturou. Ela ouviu Kenichi emitir um suspiro de alívio. Perigo controlado.

—Vazou dentro da geladeira? — perguntou Emma.

—Não. Explodiu do lado de fora. — Ele limpou o rosto com um pano com álcool, que também selou dentro de um saco plás­tico para ser eliminado sem riscos. — O saco estava... você sabe, muito inflado. Como um balão.

O conteúdo estava sob pressão, o processo de decomposição liberando gases. Através do saco plástico, podia ver a etiqueta com a data da morte. Isso é impossível, pensou. Em apenas cinco dias, o corpo se deteriorara em um purê escuro de carne podre. O saco estava frio ao toque, o que indicava que a geladeira estava funcionando. Apesar do armazenamento em ambiente frio, algo acelerara a decomposição do corpo. Estreptococos necrotizantes?, perguntou-se. Ou outra bactéria igualmente destrutiva?

Ela olhou para Kenichi e pensou: Atingiu-o no olho.

—Precisamos falar com o pesquisador principal — disse ela. — O que enviou esses ratos.

Eram apenas 5 horas na costa do Pacífico, mas a voz do Dr. Michael Loomis, pesquisador principal da experiência "Concepção e gestação em ratos durante voo espacial" estava alerta e obvia­mente preocupado. Estava falando com Emma do Centro de Pes­quisa Ames, da Califórnia. Embora ela não pudesse vê-lo, podia imaginar o homem a quem pertencia aquela voz modulada, forte e enérgica. Um homem que, às 5 horas, já havia começado o seu dia de trabalho.

—Monitoramos esses animais durante um mês — disse Loomis. — E uma experiência de estresse relativamente baixo para os animais. Planejávamos misturar os machos e as fêmeas na sema­na que vem, na esperança de que conseguissem acasalar e conce­ber. Esta pesquisa tem aplicações importantes para longas viagens no espaço. Colonização planetária. Como pode imaginar, estas mortes são muito preocupantes.

—Já temos culturas em incubação — disse Emma. — Todos os ratos mortos parecem estar se decompondo mais rapidamente do que deviam. Baseada nas condições dos corpos, estou preocu­pada com infecções por clostrídia ou estreptococos.

—Pragas assim perigosas na estação? Isso seria um problema sério.

—Exato. Especialmente em um ambiente fechado como o nosso. Estamos todos vulneráveis.

—E quanto a fazer a necropsia dos ratos mortos?

Emma hesitou.

—Aqui em cima só estamos preparados para lidar com contaminações de Nível 2. Nada mais perigoso que isso. Se isso é um patógeno grave, não posso arriscar contaminar outros animais. Ou pessoas.

Houve um breve silêncio e Loomis disse a seguir:

—Compreendo. E acho que devo concordar com você. En­tão você se livrará de todos os corpos?

—Imediatamente — disse Emma.

 

Julho 31

Pela primeira vez desde que chegara à ISS, Kenichi não conseguia dormir. Ele se fechara no saco de dormir havia horas, mas ainda estava desperto, ainda refletindo sobre o enigma do rato morto. Embora ninguém tivesse proferido uma palavra de reprovação, de algum modo ele se sentia responsável pelo fracasso da experiência. Tentou pensar no que fizera de errado. Teria usado uma agulha contaminada ao tirar amostras de sangue ou teria sido um valor errado nos ajustes de controle ambiental? Pensar em todos os er­ros possíveis que pudesse ter cometido não o deixava de dormir.

Além disso, sua cabeça latejava.

Ele notara o desconforto naquela manhã, que começara como um vago formigamento ao redor dos olhos. Ao longo do dia, o formigamento se transformara em dor, e agora toda a metade esquerda de sua cabeça doía. Não uma dor insuportável, apenas um incômodo persistente.

Ele abriu o saco de dormir. Afinal, não conseguia descansar e podia dar outra olhada nos ratos.

Passou pela estação-dormitório de Nicolai e atravessou uma série de módulos de conexão que levavam à parte americana da estação. Apenas quando entrou no laboratório foi que se deu conta de que alguém mais estava acordado.

Ouviu vozes murmuradas no laboratório anexo, o da NASDA. Silenciosamente, flutuou até o Nodo 2 e espiou através de uma escotilha aberta. Viu Diana Estes e Michael Griggs, abraça­dos, bocas unidas em um beijo ardente. Imediatamente ele retro­cedeu sem ser percebido, envergonhado com o que acabara de testemunhar.

E agora? Deveria dar-lhes privacidade e voltar para sua estação-dormitório? Isso não está certo, pensou, subitamente ressen­tido. Estou aqui para trabalhar, para realizar as minhas tarefas.

Flutuou até o habitat dos animais. Fez bastante barulho ao abrir e fechar as gavetas dos consoles. Um instante depois, como esperava, Diana e Griggs apareceram, os dois aparentemente en­vergonhados. Devem estar mesmo, pensou, considerando o que estavam fazendo.

—Tivemos um problema com a centrífuga — mentiu Diana. — Acho que agora está consertado.

Kenichi simplesmente meneou a cabeça, fingindo que não sabia a verdade.

Diana manteve-se fria como gelo, e isso tanto o chocou quanto o enfureceu. Griggs, ao menos, teve a decência de parecer um tanto culpado.

Kenichi observou enquanto saíam do laboratório e desapareciam pela escotilha. Então, voltou a atenção para o habitat dos animais. Olhou dentro da gaiola.

Outro rato morto. Uma fêmea.

 

1º de agosto

Diana Estes calmamente estendeu o braço para o torniquete e abriu e fechou a mão diversas vezes para ressaltar a veia antecubital. Não fez careta e nem desviou o olhar quando a agulha perfu­rou-lhe a pele. Na verdade, Diana estava tão ausente que podia estar vendo outra pessoa sendo picada. Todo astronauta levava diversas picadas ao longo da carreira. Durante o processo de sele­ção, passavam por diversos exames físicos e de sangue e respon­diam a perguntas mais íntimas. A química de seus sangues, ECG e contagem de células eram permanentemente registrados, para serem vasculhados por fisiologistas aeroespaciais. Arfavam e sua­vam em esteiras com eletrodos fixados ao peito, seus fluidos cor­porais eram colhidos; seus intestinos, sondados; cada centímetro de pele, examinado. Os astronautas não eram apenas pessoal altamente treinado. Também eram objetos de experiências. Eram o equivalente a ratos de laboratório e, enquanto estavam em órbita, resignavam-se a baterias de testes, às vezes dolorosos.

Aquele era dia de coleta de material. Como médico de bordo, era Emma quem empunhava as agulhas e as seringas. Não era de estranhar que os colegas tivessem lamentado quando a viram chegar.

Diana, porém, simplesmente estendeu o braço e se submeteu à agulha. Enquanto Emma esperava a seringa encher de sangue, viu o olhar da colega, que admirava sua técnica e sua habilidade. Se a princesa Diana era a rosa da Inglaterra, dizia a piada no Cen­tro Espacial Johnson, então Diana Estes era o cubo de gelo da Inglaterra, uma astronauta cuja pose nunca se abalava, mesmo no meio de uma verdadeira calamidade.

Havia quatro anos, Diana estava a bordo da Atlantis quando um motor principal falhou. Nas fitas das transmissões da tripula­ção, as vozes do comandante e do piloto do ônibus espacial se altearam, alarmadas, enquanto lutavam para levar o ônibus espa­cial para um cancelamento transatlântico. Mas não a voz de Dia­na, que podia ser ouvida lendo friamente as listas de verificação enquanto a Atlantis aproximava-se de uma aterrissagem incerta no Norte da África. O que selou a sua reputação de frieza foram as leituras da biotelemetria. Naquele lançamento em particular, toda a tripulação estava sendo monitorada para que se pudesse registrar seus batimentos cardíacos e sua pressão arterial. En­quanto as taxas cardíacas de todos disparavam, a de Diana mal acelerou, a tranquilos 96 por minuto.

—É por isso que ela não é humana — brincara Jack na ocasião. — Na verdade, ela é um andróide. O primeiro de uma nova linha de astronautas da NASA.

Emma tinha de admitir que havia algo não muito humano sobre aquela mulher.

Diana olhou para a picada no braço, viu que o sangramento parara e, muito tranquilamente, voltou à sua experiência com crescimento de cristais de proteínas. Ela de fato era quase tão per­feita quanto um andróide, membros longos e esguios, pele ima­culada e pálida como papel após um mês no espaço. Tudo isso mais um QI de gênio, de acordo com Jack, que treinara com Dia­na para a missão do ônibus espacial que ele jamais completara.

Diana tinha um doutorado em ciência de materiais e publicara mais de uma dúzia de trabalhos de pesquisa sobre zeolitos — materiais cristalinos usados no refino de petróleo — antes de ser aceita no programa de astronautas. Agora, era a cientista encarre­gada das pesquisas de cristais orgânicos e inorgânicos. Na Terra, a formação de cristais era retardada pela gravidade. No espaço, os cristais ficavam maiores e mais desenvolvidos, permitindo a aná­lise integral de suas estruturas. Centenas de proteínas humanas, da angiotensina até a gonadotropina coriônica, eram cultivadas como cristais a bordo da ISS, uma pesquisa farmacêutica vital que poderia levar ao desenvolvimento de novos remédios.

Após terminar com Diana, Emma deixou o laboratório da ESA e flutuou até o módulo habitacional para encontrar Mike Griggs.

—Você é o próximo — disse ela.

Ele gemeu e estendeu o braço, relutante.

—Tudo em nome da ciência.

—Desta vez é apenas um tubo — disse Emma, amarrando o torniquete.

—Somos tão espetados por agulhas que parecemos viciados em drogas injetáveis.

Ela deu alguns tapinhas para que a veia antecubital sobressaísse, azul e nodosa em seu braço musculoso. Griggs tinha uma obsessão por estar em forma, o que não é uma coisa fácil de se conseguir em órbita. A vida no espaço afetava muito o corpo hu­mano. Os rostos dos astronautas eram intumescidos, inchados por mudanças no comportamento dos fluidos. Os músculos das coxas e panturrilhas encolhiam até eles ficarem com "pernas de galinha" despontando pálidas e magras de seus shorts de colegial. As tarefas eram exaustivas, as irritações por demais numerosas para serem contadas. E havia também o custo emocional de ser confinado durante meses com colegas da tripulação estressados, sujos e usando roupas fedorentas.

Emma passou uma mecha com álcool sobre a pele e perfurou a veia. O sangue entrou na seringa. Ela olhou para ele e viu que Griggs desviava o olhar.

—Tudo bem?

—É. Eu gosto de um vampiro habilidoso.

Ela liberou o torniquete e ouviu o suspiro de alívio quando retirou a agulha.

—Pode tomar o seu café agora. Já tirei sangue de todo mun­do, menos de Kenichi.

Ela olhou ao redor no módulo habitacional.

—Onde ele está?

—Eu não o vi esta manhã.

—Espero que não tenha comido. Vai arruinar os níveis de glicose.

Nicolai, que flutuava a um canto terminando o seu desjejum em silêncio, disse:

— Ele ainda está dormindo.

—Estranho — disse Griggs. — Ele sempre se levanta antes de todo mundo.

—Ele não dormiu bem esta noite — informou Nicolai. — Eu o ouvi vomitando. Perguntei se precisava de ajuda, mas ele disse que não.

—Vou vê-lo — disse Emma.

Ela deixou o módulo habitacional e subiu o longo túnel até o RSM, onde ficava a estação-dormitório de Kenichi. Encontrou a cortina fechada.

—Kenichi? — chamou. Não houve resposta. — Kenichi?

Ela hesitou um instante, então abriu a cortina e olhou para o rosto do colega.

Seus olhos estavam vermelhos-vivos.

Oh, meu Deus — exclamou Emma.

 

A Doença

O cirurgião de voo ao console do Controle da Missão da ISS era o Dr. Todd Cutler, um médi­co de rosto tão jovem que os astronautas o apelidaram de "Doogie Howser" por causa da série de TV sobre um médico adoles­cente. Cutler tinha, na verdade, 32 anos e era reconhecido por ser sereno e competente. Fora o médico particular de Emma quando ela estivera em órbita e, uma vez por semana, durante suas reuniões médicas particulares, ela conversava com ele em circuito fechado de comunicação, relatando detalhes os mais íntimos sobre sua saúde. Emma confiava nas habilidades médi­cas de Todd e sentia-se aliviada por ele ser o cirurgião de plan­tão naquela hora na sala do controle da missão da ISS no Cen­tro Espacial Johnson.

—Ele está com hemorragias nas escleras de ambos os olhos — disse ela. — Fiquei apavorada quando vi. Acho que ficou assim por ter vomitado tanto na noite passada. A súbita mudança de pressão estourou alguns vasos nos seus olhos.

—No momento, esta é uma pieocupação menor. As hemorragias vão se dissipar — disse Todd. — E quanto ao resto do exame?

—Está com uma febre de 38,5. Pulso 1 por 20, pressão arte­rial 10 por 6. O coração e os pulmões parecem bem. Reclama de dor de cabeça, mas não detectei qualquer mudança neurológica. O que realmente me preocupa é o fato dele não ter sons nos in­testinos e seu abdome estar difusamente dolorido. Ele vomitou diversas vezes na última hora. Até agora, sem sangue.

Emma fez uma pausa.

—Todd, ele parece doente. E aqui vão as más notícias. Acabei de verificar seu nível de amilase. Está em 600.

Oh, merda. Você acha que ele está com pancreatite?

—Com esse aumento de amilase, é bem possível.

A amilase é uma enzima produzida pelo pâncreas, e seus níveis geralmente sobem às alturas quando o órgão fica inflamado. Mas um alto nível de amilase também podia indicar outros pro­cessos abdominais agudos. Uma perfuração de intestino ou uma úlcera duodenal.

—A contagem de glóbulos brancos também está alta — disse Emma. — Fiz culturas do sangue, só por segurança.

—Qual o histórico? Alguma coisa digna de nota?

—Duas. Primeiro, ele está sob estresse emocional. Uma de suas experiências falhou, e ele se sente responsável.

—E a segunda?

—Há dois dias ele foi atingido no olho pelos fluidos corpo­rais de um rato de laboratório morto.

—Fale-me mais a esse respeito — murmurou Todd.

—Os ratos da experiência dele têm morrido por razões desconhecidas. Os corpos vêm se decompondo a uma taxa surpreen­dentemente rápida. Eu estava preocupada com bactérias patogê­nicas, de modo que peguei amostras dos fluidos corporais para cultura. Infelizmente, todas essas culturas foram arruinadas.

—Como?

—Acho que é contaminação por fungos. As lâminas ficaram completamente verdes. Nenhum patógeno conhecido foi identi­ficado. Tive de descartar as lâminas. O mesmo aconteceu com outra experiência, uma cultura de células de organismos mari­nhos. Tivemos de cancelar o projeto por causa de fungos no tubo de cultura.

Infelizmente, a proliferação de fungos não era um problema incomum em lugares fechados como a ISS, apesar de o ar ser con­tinuamente renovado. A bordo da antiga estação Mir,as janelas às vezes ficavam cobertas de uma fina camada de fungos. Uma vez que o ar de uma espaçonave é contaminado por esses orga­nismos, é quase impossível eliminá-los. Por sorte, em sua maio­ria, os fungos eram inofensivos para as pessoas e para os animais do laboratório.

—Então não sabemos se ele se expôs a algum patógeno — disse Todd.

—Não. No momento, parece mais um caso de pancreatite, não de infecção por bactérias. Coloquei-o no soro e acho que é hora de um tubo nasogástrico.

Ela fez uma pausa e acrescentou, relutante:

—Precisamos pensar em uma evacuação de emergência.

Houve um longo silêncio. Aquele era um cenário que todos temiam, a decisão que ninguém queria tomar. O Veículo de Re­torno de Tripulação, que permanecia acoplado à ISS sempre que havia pessoal a bordo, era grande o bastante para evacuar todos os seis astronautas. Uma vez que as cápsulas Soyuz não estavam mais funcionando, o CRV era o único veículo de fuga da estação. Caso partisse, teria de levar todos a bordo. Por causa de um mem­bro doente da tripulação, seriam forçados a abandonar a ISS, in­terrompendo centenas de experiências. Seria um duro golpe para a estação.

Mas havia uma alternativa. Podiam esperar o próximo voo do ônibus espacial para evacuar Kenichi. Agora, tudo dependia de uma decisão médica. Ele poderia esperar? Emma sabia que a NASA confiava no seu julgamento clínico, e a responsabilidade pesava sobre os seus ombros.

—E quanto a um resgate no ônibus espacial? — perguntou.

Todd Cutler compreendeu o dilema.

—A Discoveryestá na plataforma para o STS 161, lançamento previsto para daqui a 15 dias. Mas sua missão é militar e confiden­cial. Recuperação e reparo de satélite. A tripulação da 161 não está se preparando para encontro e acoplagem com a ISS.

—E que tal substituí-los pela equipe de Kittredge? Minha antiga tripulação do 162? Estão programados para acoplar aqui em sete semanas. Estão inteiramente preparados.

Emma olhou para Mike Griggs, que flutuava ali perto, ouvindo a conversa. Como comandante da ISS, seu principal objetivo era manter a estação funcionando e se opunha firmemente a abandoná-la. Ele se juntou à conversa.

—Cutler, aqui é Griggs. Se a minha tripulação abandonar a nave, perderemos experiências. São meses de trabalho que irão por água abaixo. Um resgate com o ônibus espacial faz mais sen­tido. Se Kenichi precisa ir para casa, então venham buscá-lo. Dei­xe que o resto de nós fique aqui para fazer o trabalho.

—O resgate pode esperar tanto assim? — perguntou Todd.

—Em quanto tempo podem mandar esse pássaro aqui para cima? — perguntou Griggs.

—Precisamos falar com a logística. Janelas de lançamento...

—Apenas nos diga quanto tempo.

Cutler fez uma pausa.

Ellis, o Diretor de Vôo, está esperando para entrar no circuito de comunicação. Vá em frente, Vôo.

O que começara como uma conversa fechada e confidencial entre dois médicos estava agora aberta ao diretor de vôo. Ouvi­ram Woody Ellis dizer:

—Trinta e seis horas. É o mínimo de que precisamos.

Muita coisa podia acontecer em 36 horas, pensou Emma. Uma úlcera podia ser perfurada ou sangrar. A pancreatite podia levar ao choque e ao colapso circulatório.

Ou Kenichi podia se recuperar completamente, vítima de nada mais que uma grave infecção intestinal.

—É a Dra. Watson quem está examinando o paciente — dis­se Ellis. — Estamos confiando no discernimento dela. Qual é a sua opinião clínica?

Emma pensou a respeito.

—Ele não apresenta um quadro de abdome agudo cirúrgico. Não no momento. Mas as coisas podem piorar rapidamente.

—Então, você não está segura.

—Não, não estou.

—No instante em que se decidir, ainda precisaremos de 24 horas para abastecimento.

Um intervalo de um dia inteiro entre o período de resgate e o lançamento, mais o tempo adicional para o encontro em órbita. Se Kenichi subitamente piorasse, conseguiria mantê-lo vivo todo esse tempo? A situação se tornara extremamente complicada. Ela era uma médica, não uma vidente. Não tinha aparelho de radio­grafia à sua disposição, nenhuma sala de cirurgia. Os exames físi­cos e de sangue estavam anormais, mas não eram específicos. Se ela escolhesse retardar o resgate, Kenichi podia morrer. Se ela chamasse ajuda muito cedo, milhões de dólares seriam desperdi­çados em um lançamento desnecessário.

Uma decisão errada, fosse qual fosse, acabaria com a sua carreira na NASA.

Esta era a corda bamba a respeito da qual Jack a advertira. Eu erro, e o mundo inteiro vai ficar sabendo. Eles estão esperando para ver se sou uma Eleita.

Ela olhou para o resultado do exame de sangue de Kenichi. Nada ali justificava apertar o botão do pânico. Não ainda.

Voo, vou mantê-lo no soro e começar a sucção nasogástrica. No momento, seus sinais vitais estão estáveis. Só queria saber o que está acontecendo na barriga dele.

—Então, na sua opinião, um lançamento de emergência do ônibus espacial ainda não é indicado?

Ela suspirou profundamente.

—Não. Ainda não.

—De qualquer modo, estaremos prontos para enviar a Discovery,caso seja necessário.

—Agradeço. Volto a falar com você mais tarde com um boletim médico atualizado. — Ela desligou e olhou para Griggs. — Espero estar fazendo a coisa certa.

—Apenas cure-o, está bem?

Emma foi ver como estava Kenichi. Ele precisaria de atenção durante toda a noite, motivo pelo qual ela o tirou do módulo habitacional e levou-o ao laboratório dos EUA, de modo a não perturbar o sono do restante da tripulação. Kenichi estava fecha­do em um saco de dormir. Uma bomba de infusão alimentava um fluxo contínuo de solução salina em suas veias. Ele estava desperto e, obviamente, incomodado.

Luther e Diana, que observavam o paciente, pareceram aliviados ao verem Emma.

—Ele vomitou outra vez — disse Diana.

Emma ancorou os pés para manter a posição e levou o estetoscópio ao ouvido. Suavemente, posicionou o diafragma no ab­dome de Kenichi. Ainda sem sons intestinais. Seu trato digestivo se fechara, e o fluido começaria a se acumular no seu estômago. Este fluido precisava ser drenado.

Kenichi — disse ela. — Vou inserir um tubo em seu estômago. Vai ajudar com a dor e, talvez, você pare de vomitar.

—Que... que tubo?

—Um tubo nasogástrico.

Ela abriu o kit médico ALSP. Lá dentro havia uma ampla variedade de instrumentos e remédios, uma coleção tão completa quanto a de uma ambulância moderna. Na gaveta "Vias aéreas", havia diversos tubos, instrumentos de sucção, sacos de coleta e um laringoscópio. Ela abriu o saco que continha o longo tubo nasogástrico. Era fino e estava enrolado, feito de plástico flexível, com uma ponta perfurada.

Os olhos vermelhos de Kenichi se arregalaram.

— Serei tão delicada quanto puder — disse ela. — Você poderá ajudar tomando um gole de água quando eu pedir. Vou in­serir esta extremidade em sua narina. O tubo descerá pela sua garganta, e quando você engolir a água, o tubo entrará no seu estômago. A única parte desconfortável será logo no inicio, quan­do eu o introduzir em sua narina. Depois que estiver no lugar, quase não o incomodará.

—Quanto tempo isso ficará dentro de mim?

—Um dia, pelo menos. Até seus intestinos voltarem a funcionar — acrescentou Emma, — É realmente necessário, Kenichi.

Ele suspirou e assentiu.

Emma olhou para Luther, que parecia cada vez mais horrorizado com a ideia do tubo.

—Ele vai precisar de um gole de água. Poderia buscar um pouco?

Então, ela olhou para Diana, que flutuava ali perto. Como sempre, Diana parecia imperturbável, friamente distante da crise.

—Preciso do dispositivo de sucção nasogástrica.

Diana automaticamente procurou o instrumento de sucção e a bolsa coletora no kit ALSP.

Emma desenrolou o tubo nasogástrico. Primeiro, mergulhou a ponta em gel lubrificante, para facilitar a passagem através da nasofaringe. Então, entregou a Kenichi o saco que Luther enche­ra de água.

Ela apertou o braço de Kenichi para dar-lhe confiança. Embora seus olhos estivessem arregalados de medo, ele retribuiu o gesto com um menear de cabeça.

A extremidade perfurada do tubo brilhava com o gel lubrificante. Ela inseriu a ponta na narina direita de Kenichi e delicada­mente a empurrou em sua nasofaringe. Ele engasgou, olhos lacrimejantes, e começou tossir em protesto quando o tubo passou por sua garganta. Ela empurrou a sonda mais fundo. Agora ele se debatia, lutando contra o incontrolável instinto de empurrá-la para longe e arrancar o tubo do nariz.

—Engula um pouco de água — exigiu Emma.

Ele inspirou e, com a mão trêmula, levou o canudo aos lábios.

—Engula, Kenichi — disse ela.

Quando um glóbulo de água atravessa a garganta e entra no esôfago, a epiglote fecha a abertura da traqueia, evitando qualquer vazamento para os pulmões. Também faz passar o tubo pela aber­tura certa. No instante em que viu que ele começava a engolir, ela rapidamente empurrou o tubo nasogástrico, fazendo-o atravessar a garganta e o esôfago, até a ponta chegar ao estômago.

—Pronto — disse ela, fixando o tubo ao seu nariz. — Você se saiu muito bem.

—A sucção está pronta — disse Diana.

Emma conectou o tubo nasogástrico ao instrumento de sucção. Ouviram um borbulhar, então apareceu um líquido no tubo que fluía do estômago de Kenichi para dentro do saco de drena­gem. Era de um verde bilioso, mas não era sangue, percebeu

Emma, aliviada. Talvez esse fosse todo o tratamento de que ele precisava: descanso intestinal, sucção nasogástrica e soro, Se ele de fato estivesse com uma pancreatite, esta terapia o faria aguentar os próximos dias, até a chegada do ônibus espacial.

—Minha cabeça... está doendo — disse Kenichi, fechando os olhos.

—Vou lhe dar algo para a dor — disse Emma.

—Então, o que acha? A crise foi evitada?

Era Griggs falando. Ele observara o procedimento da escoti­lha e, embora o tubo já tivesse sido inserido, continuava longe, como se sentisse nojo de ver alguém doente. Ele sequer olhava para o paciente. Em vez disso, mantinha os olhos fixos em Emma.

—Veremos — disse ela.

—O que digo para Houston?

—Acabei de inserir o tubo. É muito cedo.

—Precisam saber logo.

—Bem, eu não sei! — disse ela, irritada. Então, engolindo em seco, acalmou-se. — Podemos discutir isso no módulo habitacional?

Ela deixou Luther com o paciente e atravessou a escotilha.

No módulo habitacional, ela e Griggs se juntaram a Nicolai. Reuniram-se na mesa da cozinha como se compartilhassem uma refeição. Contudo, o que de fato compartilhavam eram as suas frustrações por conta da incerteza da situação.

—Você é a médica — disse Griggs. — Não pode tomar uma decisão?

—Ainda estou tentando estabilizá-lo — disse Emma. — No momento, ainda não sei com o que estou lidando. Pode se resol­ver em um ou dois dias. Ou pode ficar pior de uma hora para a outra.

—E você não sabe nos dizer qual das duas coisas vai acontecer.

—Sem radiografia, sem uma sala cirúrgica, não posso saber o que está acontecendo dentro dele. Não posso prever como ele estará amanhã.

- Ótimo.

—Acho que ele devia ir para casa. Gostaria que lançassem o quanto antes.

- E quanto a uma evacuação com o CRV? — perguntou Nicolai.

—Um voo controlado a bordo do ônibus espacial é sempre mais indicado para transportar um paciente enfermo — disse Emma.

Um retorno a bordo do CRV era um passeio difícil e, a depender das condições meteorológicas, talvez não conseguissem aterrissar em um local adequado para o transporte médico.

—Esqueça o CRV — disse Griggs. — Não abandonaremos a estação.

—Se a situação ficar crítica... — disse Nicolai.

—Basta que Emma o mantenha vivo até a chegada da Discovery.Droga, esta estação é como uma ambulância orbital! Ela tem de ser capaz de mantê-lo estável.

- E se ela não puder? — pressionou Nicolai. — A vida de um homem vale mais que todas essas experiências.

—Será a nossa última opção — disse Griggs. — Se entrarmos no CRV, estaremos abandonando meses de trabalho.

—Veja, Griggs — disse Emma. — Assim como você, eu também não quero deixar a estação. Lutei muito para chegar aqui em cima e não quero encurtar a minha estadia. Mas se meu paciente precisar de resgate imediato, então será isso o que decidirei.

—Perdão, Emma — disse Diana, entrando pela escotilha. — Acabei de fazer o último exame de sangue de Kenichi. Acho que devia ver isso.

Diana entregou-lhe uma folha de papel.

Emma olhou para os resultados: Creatina-quinase: 20,6 (normal de 0 a 3,08).

Aquela doença era mais que uma pancreatite, mais do que apenas uma perturbação gastrintestinal. Um resultado de CQ alta indicava dano muscular ou cardíaco.

Vomitar, às vezes, é um sintoma de ataque cardíaco.

Ela olhou para Griggs.

—Acabo de me decidir — disse ela. — Diga para Houston enviar o ônibus espacial. Kenichi tem de voltar para casa.

 

2 de agosto

Jack apertou o cabo da bujarrona, braços bronzeados brilhando de suor enquanto lutava com a manivela. A vela se enfunou e o Sanneke adernou para sotavento, o casco atravessando as águas barrentas da baía de Galveston. Deixara o golfo do México para trás. Fizera a volta em Point Bolívar mais cedo naquela tarde, evi­tando o tráfego marítimo de Galveston Island, e agora passava ao largo das refinarias no litoral de Texas City enquanto navegava para o norte em direção a Clear Lake. De volta para casa.

Após quatro dias no golfo, sua pele estava morena e seus cabelos, desgrenhados. Ele não informara ninguém a respeito de seus planos, simplesmente estocara comida e navegara em dire­ção ao mar aberto, longe da terra, em meio a noites escuras reple­tas de estrelas. Deitado de costas sobre o convés, as águas do gol­fo balançando o casco da embarcação, observara o céu noturno durante horas a fio. Com as estrelas se espalhando em todas as direções, quase conseguia se imaginar atravessando o espaço, como se cada oscilar do barco o empurrasse mais profundamente em direção à espiral de uma outra galáxia. Ele esvaziara a mente de tudo que não fosse estrelas ou mar. Então, um meteoro bri­lhante atravessou o céu, e ele subitamente pensou em Emma.

Jack não conseguia levantar muros altos o bastante para mantê-la a distância. Ela estava sempre ali, pairando no limiar, esperando para imiscuir-se em seus pensamentos quando ele menos espera­va. Quando menos queria. Ficou rígido, os olhos fixos no risco deixado pelo meteoro. Embora nada mais tivesse mudado, nem na direção do vento nem no oscilar do barco, de uma hora para a outra ele se sentiu subitamente sozinho.

Ainda estava escuro quando Jack levantou as velas para voltar para casa.

Agora, enquanto subia o canal rumo a Clear Lake, observan­do a silhueta dos telhados das casas contra o brilho do sol poen­te, lamentou a decisão de ter voltado mais cedo. No golfo sopra­va uma brisa constante, mas ali o calor e a umidade eram asfixiantes.

Jack atracou e caminhou pelo cais, as pernas bambas por conta dos dias que passara no mar. Primeira coisa a fazer, pensou, tomar um banho frio. Deixaria para limpar o barco à noite, quan­do estivesse mais fresco. Quanto a Humphrey, bem... outro dia no gatil não faria mal àquela bola de pelos.

Carregando a bolsa de lona, Jack passava pela pequena mercearia da marina quando olhou para a banca de jornal. A bolsa caiu de sua mão. Ele olhou para a manchete do Houston Chronicle daquela manhã:

"Começa a contagem regressiva do ônibus espacial: lançamento de emergência será amanhã."

O que aconteceu?, pensou. O que deu errado?

Com mãos trêmulas, tirou algumas moedas do bolso, en­fiou-as na máquina e pegou um exemplar. Duas fotografias ilustravam a matéria. Uma era de Kenichi Hirai, o astronauta da NASDA do Japão. A outra era de Emma.

Ele pegou o saco de lona e correu para procurar um telefone.

Havia três cirurgiões de voo na reunião, uma indicação de que enfrentavam uma crise de natureza médica. Ao entrar na sala, todas as cabeças se voltaram em sua direção, surpresas. Jack in­tuiu a pergunta não dita nos olhos do diretor de vôo da estação espacial, Woody Ellis: O que Jack McCallum está fazendo aqui?

O Dr. Todd Cutler deu a resposta.

—Jack ajudou a desenvolver nosso protocolo de procedimentos de emergência médica para a primeira tripulação da esta­ção. Achei que devia se juntar a nós.

Apreensivo, Ellis disse:

— O envolvimento pessoal complica tudo.

Referia-se a Emma.

—Cada membro daquela tripulação é como um parente para nós — disse Todd. — Portanto, de certa forma, tudo é pessoal.

Jack sentou-se ao lado de Todd. À mesa estavam o diretor assistente do NSTS, o diretor de operações da ISS, cirurgiões de vôo e diversos gerentes de programa. Também presente estava a diretora de relações públicas da NASA, Gretchen Liu. Com exce­ção dos dias de lançamento, a imprensa ignorava a maior parte das operações da NASA. Naquele dia, porém, jornalistas de todas as agências de notícias se acotovelavam na exígua sala de coletivas de imprensa no prédio de informação pública da NASA, esperan­do a aparição de Gretchen. Como as coisas podem mudar em um dia, pensou Jack. A atenção do público é volátil. Exigia explosões, tragédia, crise. O milagre de uma operação impecável não cha­mava a atenção de ninguém.

Todd passou-lhe uma pilha de papéis com uma nota rabisca­da no topo: "Resultados clínicos e de laboratório de Hirai nas últi­mas 24 horas. Seja bem-vindo."

Jack folheou o boletim médico enquanto assistia à reunião. Tinha de ficar a par do que acontecera naquelas 24 horas e demo­rou um pouco até absorver o essencial. O astronauta KenichiHirai estava muito doente, e seus exames de laboratório intriga­vam a todos. O ônibus espacial Discovery estava pronto para ser lançado às 6 horas, horário da Costa Leste, pilotado pela tripula­ção de Kittredge, acrescida de um médico astronauta. A conta­gem regressiva estava no horário.

Alguma alteração em suas recomendações? perguntou o diretor assistente do NSTS aos cirurgiões de vôo. Ainda acham que Hirai pode esperar para ser resgatado no ônibus espacial?

Todd Cutler respondeu:

Ainda acreditamos que um resgate no ônibus espacial é a opção mais segura. Não mudamos nossas recomendações a este respeito. AISS é uma instalação bem equipada, com todas as dro­gas e equipamentos necessários para uma ressuscitação cardio-pulmonar.

Então você ainda acredita que ele teve um ataque cardíaco?

Todd olhou para os colegas cirurgiões.

Francamente, não temos certeza absoluta admitiu. Algumas coisas apontam para um infarto do miocárdio, um ata­que cardíaco, para os leigos. Principalmente, pelos níveis cres­centes de enzimas cardíacas no seu sangue.

Então, por que ainda não têm certeza?

O ECG só mostra alterações inespecíficas. Algumas inversões de ondas T. Não é um padrão clássico para um infarto do miocárdio. Hirai também foi inteiramente analisado em busca de doença cardiovascular antes de ser aceito no programa. Ele não tinha fatores de risco. Francamente, não estamos certos do que está acontecendo. Mas temos de assumir que teve um ataque car­díaco. O que torna um resgate pelo ônibus espacial a nossa me­lhor opção. E uma reentrada mais tranquila e uma aterrissagem controlada. Muito menos estresse do que se ele voltasse para casa de CRV. Nesse meio-tempo, a ISS poderá lidar com quaisquer arritmias que ele venha a apresentar.

Jack tirou os olhos dos exames laboratoriais que examinava.

—Sem o equipamento de laboratório necessário, a estação não pode fracionar esses níveis de creatina quinase. Portanto, como ter certeza de que essa enzima de fato vem do coração?

Todos se voltaram para ele.

—O que quer dizer com "fracionar"? — perguntou Woody Ellis.

—A creatina quinase é uma enzima que ajuda as células musculares a utilizar a energia armazenada. É encontrada tanto nos músculos estriados quanto nos cardíacos. Quando há dano às cé­lulas do coração, digamos, como em um ataque cardíaco, o nível de CQ aumenta no sangue. É por isso que estamos supondo que ele teve um ataque do coração. Mas e se não for o coração?

—O que mais poderia ser?

—Algum outro tipo de dano muscular. Trauma, por exem­plo. Ou convulsões. Inflamação... Na verdade, uma simples inje­ção intramuscular pode aumentar o nível de CQ. É preciso fracionar a CQ para saber se vem do coração. Não há como fazer esse exame na estação.

—Então ele pode não ter tido um infarto.

—Correto. E aqui vai outro detalhe intrigante. Após um dano grave nos músculos, os níveis de CQ voltam ao normal. Mas vejam o padrão. — Jack folheou os resultados de laboratório e leu os resultados. — Nas últimas 24 horas, seus níveis têm subi­do regularmente. O que indica dano contínuo.

—Isso é apenas parte do enigma maior — disse Todd. — Temos resultados anormais em todos os aspectos, sem qualquer pa­drão reconhecível. Enzimas do fígado, anomalias renais, taxa de sedimentação, contagem de glóbulos brancos. Alguns indicado­res sobem enquanto outros baixam. E como se diferentes siste­mas de órgãos estivessem sendo atacados em turnos.

Jack olhou para Todd.

—Atacados?

—Apenas uma figura de retórica, Jack. Não sei com que tipo de processo estamos lidando. Sei que não é um erro de laborató­rio. Fizemos exames em outros membros da tripulação, e todos estão perfeitamente normais.

—Mas ele está doente o bastante para justificar um resgate?

A pergunta foi feita pelo diretor de operações da missão do ônibus espacial, que não estava contente com coisa alguma da­quilo. A missão original da Discoveryseria recuperar e reparar o satélite espião Capricorn. Agora, a sua missão fora desviada por aquela crise.

—Washington não está gostando da ideia de adiar o reparo do satélite. Vocês se apoderaram do voo deles para que a Discovery possa servir de ambulância voadora. Isso é realmente neces­sário? Hirai não poderia se recuperar na estação?

—Não podemos prever. Não sabemos o que há de errado com ele — respondeu Todd.

—Vocês têm uma médica lá em cima, pelo amor de Deus! Ela não pode descobrir?

Jack ficou tenso. Aquilo fora um ataque contra Emma.

—Ela não tem visão de raios X — disse ele.

—Mas tem tudo o mais à sua disposição. Como você chama­va a estação, Dr. Cutler? Uma instalação médica bem equipada?

—O astronauta Hirai precisa voltar para casa o mais rapidamente possível — disse Todd. — Esta continua sendo a nossa posição. Se quiser questionar a opinião de seus cirurgiões de voo, a escolha é sua. Tudo o que posso dizer é que nunca tive a preten­são de questionar a opinião de um engenheiro de sistemas de propulsão.

Aquilo encerrou de vez a discussão.

O diretor assistente do NSTS disse:

—Há alguma outra preocupação?

—O tempo — disse o meteorologista da NASA. — Acho que mencionei o fato de haver tempestades se desenvolvendo a oeste de Guadalupe e movendo-se muito lentamente para o oeste. Não afetará o lançamento. Mas, a depender de sua trajetória, poderá vir a ser um problema para o pessoal do Centro Espacial Kennedy na semana que vem.

— Obrigado pela advertência. — O diretor assistente olhou em torno da sala. Ninguém tinha mais perguntas. — Então o lan­çamento continua confirmado para as 5 horas, horário da Costa Leste. Vejo todos vocês lá.

 

Punta Arena, México

À luz do poente, o mar de Cortês brilhava como prata batida. De sua mesa na varanda do Las Tres Virgenes Café, Helen Koenig via barcos de pesca voltando para Punta Colorado. Aquela era a hora do dia que ela mais gostava, a brisa fresca de fim de tarde contra sua pele queimada de sol, os músculos agradavelmente doloridos por conta da natação ves­pertina. Um garçom se aproximou e pousou uma taça de margarita à sua frente.

— Gracias, senor murmurou ela.

Seus olhos se cruzaram um instante, e ela viu um homem tranquilo e digno, com olhos cansados e cabelo repleto de mechas grisalhas, e sentiu-se ligeiramente incomodada. Culpa ian­que, pensou, observando-o enquanto voltava para o bar, uma sensação que experimentava toda vez que ia à Baja Califórnia. Bebeu um gole de seu drinque e olhou para o mar, ouvindo os trompetes de uma banda de mariachi que tocava em algum lugar na praia.

Aquele fora um bom dia no qual passara a maior parte do tempo dentro d'água. Um mergulho com dois tanques pela ma­nhã seguido de um mergulho mais raso à tarde. Então, pouco antes do jantar, nadara nas águas douradas pelo pôr do sol. O mar era o seu conforto, seu santuário. Sempre fora assim. Ao contrário do amor de um homem, o mar era constante e jamais a desapontara. Estava sempre pronto a abraçá-la, a consolá-la. Em seus momentos de crise, ela sempre procurava refúgio em seus braços obsequiosos.

Foi por isso que viera para a Baja. Para nadar em águas mornas e ficar a sós em um lugar onde ninguém pudesse encontrá-la. Nem mesmo Palmer Gabriel.

Seus lábios estavam enrugados pelo travo da margarita. Ela ter­minou o drinque e pediu um segundo. O álcool já a fazia se sentir flutuar. Não importava; agora era uma mulher livre. O projeto es­tava encerrado, cancelado. As culturas destruídas. Embora Palmer estivesse furioso com ela, Helen sabia ter feito a coisa certa. A coisa mais segura. No dia seguinte, dormiria até mais tarde e pediria chocolate quente e huevos rancheros no desjejum. Então, voltaria a mergulhar, outro retorno ao seu amante verde-esmeralda.

A risada de uma mulher atraiu sua atenção. Helen olhou para o bar onde flertava um casal: uma mulher magra e bronzeada e um homem com músculos que pareciam cabos de aço. Um caso de férias acontecendo. Provavelmente jantariam juntos, cami­nhariam pela praia de mãos dadas. Então, haveria um beijo, um abraço, todos os rituais carregados de hormônios do acasalamen­to. Helen observou-os tanto com interesse científico quanto com inveja feminina. Ela sabia que tais rituais não se aplicavam em seu caso. Ela tinha 49 anos e parecia ter esta idade. Estava com a cin­tura larga, mais da metade do cabelo grisalho, e seu rosto era inexpressivo afora a inteligência dos olhos. Ela não era o tipo de mulher que atraísse olhares de Adónis bronzeados.

Helen terminou a segunda margarita. Agora, a sensação de estar flutuando espalhou-se por todo o seu corpo, e ela soube que era hora de comer algo. Ela abriu o menu. "Restaurante de Las Tres Virgenes" dizia no topo. As três virgens. Local apropriado para ela comer. Ela bem que podia ser uma virgem.

O garçom se aproximou para anotar o pedido. Helen acabara de escolher o dorado grelhado quando olhou para a TV sobre o bar, para a imagem do ônibus espacial posicionado na platafor­ma de lançamento.

—O que está havendo? — disse ela, apontando para a TV.

O garçom deu de ombros.

—Aumente o som — gritou ela para o barman. — Por favor! Preciso ouvir isso!

Ele aumentou o volume, e Helen ouviu uma transmissão em inglês. Era um canal dos EUA. Ela foi até o balcão do bar e olhou para a televisão.

—... resgate médico do astronauta Kenichi Hirai. A NASA não liberou qualquer informação adicional, mas os relatórios in­dicam que os cirurgiões de voo continuam perplexos com a sua doença. Baseado nos exames de sangue de hoje, os médicos acha­ram ser prudente lançar uma missão de resgate no ônibus espa­cial. A Discoverytem lançamento previsto para amanhã, às 6 ho­ras, horário da Costa Leste.

Senora?— perguntou o garçom.

Helen voltou-se e viu que ele ainda segurava o bloco de notas.

—Quer outro drinque?

—Não, eu preciso ir.

—Mas a sua comida...

Cancele o pedido, por favor.

Ela abriu a bolsa, entregou-lhe 15 dólares e saiu correndo do restaurante.

De volta ao seu quarto de hotel, tentou ligar para Palmer Gabriel em San Diego. Teve de tentar seis vezes antes de conseguir falar com a telefonista internacional, e quando a chamada final­mente foi completada, só conseguiu falar com o correio de voz de Palmer.

—Eles estão com um astronauta doente na ISS — disse ela. — Palmer, era isso o que eu temia. Aquilo sobre o que eu o adverti. Se for confirmado, teremos de ser rápidos. Antes...

Ela fez uma pausa olhando para o relógio. Ora, dane-se, pensou, e desligou. Preciso voltar para casa em San Diego. Sou a única que sabe como lidar com isso. Vão precisar de mim.

Ela jogou as roupas em uma mala de viagem, encerrou a con­ta do hotel e entrou em um táxi para a viagem de 24 quilômetros até o minúsculo campo de pouso de Buena Vista. Um pequeno avião estaria esperando para levá-la até La Paz, onde poderia pe­gar um voo comercial para San Diego.

A viagem de táxi foi péssima, a estrada, esburacada e tortuo­sa, a poeira entrando pela janela aberta. Mas a parte da viagem que ela mais temia era o voo que faria a seguir. Aviões pequenos a aterrorizavam. Não fosse a pressa de voltar para casa, faria o longo trajeto da Baja Península em seu próprio carro, agora esta­cionado em segurança no resort onde estava hospedada. Ela agar­rou o assento das poltronas com as mãos suadas, imaginando que tipo de desastre aéreo a esperava.

Então, viu um relance de céu noturno, negro e aveludado, e pensou nas pessoas a bordo da estação espacial. Pensou nos riscos que outros seres humanos mais corajosos estavam correndo. Tudo era uma questão de perspectiva. Uma viagem em um pe­queno avião não era nada comparada aos perigos que um astro­nauta tinha de enfrentar.

Não era hora de ser covarde. Vidas poderiam estar em jogo. E ela era a única que sabia o que fazer a respeito.

A viagem de chacoalhar os ossos subitamente ficou mais tranquila. Estavam em uma estrada pavimentada agora, graças a Deus, e Buena Vista estava a apenas alguns quilômetros de dis­tância.

Sentindo a urgência daquela viagem, o motorista acelerou, e o vento entrou pelas janelas abertas, ferindo o seu rosto com a areia que carregava. Ela estendeu a mão para baixar o vidro. Foi quando sentiu o carro dar uma guinada para a esquerda para ul­trapassar um carro mais lento. Ela ergueu a cabeça e viu, para seu horror, que estavam em uma curva.

— Senor ! Más despacio! — disse ela. Devagar.

Estavam lado a lado com outro carro e o táxi continuava a acelerar, o motorista sem querer desistir da ultrapassagem. A es­trada à frente fazia uma curva fechada para esquerda.

—Não ultrapasse! — disse ela. — Por favor, não.

Ela olhou para frente e ficou paralisada ao ver as luzes ofuscantes de outro carro.

Helen ergueu os braços para cobrir o rosto, ocultando o bri­lho daquelas luzes. Mas não teve como calar o cantar dos pneus e nem o seu próprio grito enquanto os faróis avançavam em sua direção.

 

3 de agosto

Sentado atrás da divisória de vidro do superlotado auditório de visitantes, Jack tinha uma visão clara da sala de controle de vôo, onde cada console estava ocupado, cada controlador impecavel­mente vestido para aparecer na TV. Embora os homens e mulhe­res que trabalhavam lá embaixo estivessem intensamente con­centrados em seu trabalho, eles nunca se esqueciam inteiramente de que estavam sendo observados, que o olhar da opinião pública estava voltado para eles, e que cada gesto, cada balançar de cabe­ça, podia ser visto através da parede de vidro atrás deles. Havia apenas um ano, Jack ocupara o console do cirurgião de voo du­rante um lançamento do ônibus espacial e sentira o olhar daque­les estranhos como um vago, embora desconfortável, calor em sua nuca. Ele sabia que as pessoas lá embaixo estavam sentindo aquilo agora.

A atmosfera na FCR parecia extremamente calma, assim como as vozes no sistema de comunicação. Era a imagem que a NASA lutava para manter, a de profissionais fazendo direito o seu trabalho. O que o público raramente via eram as crises nas salas de controle dos fundos, os quase desastres, o caos que impe­rava quando as coisas davam errado e reinava a confusão.

Mas não hoje, pensou ele. Carpenter está no comando, e tudo dará certo.

O diretor de voo Randy Carpenter liderava a equipe de ascensão.

Ele tinha idade e experiência suficientes para ter testemunhado uma infinidade de crises durante a sua carreira. Ele acreditava que as tragédias durante voos espaciais geralmente não eram re­sultado de um grande defeito, mas sim de uma série de pequenos problemas que se acumulavam até resultarem em desastre. Por isso, era um aficionado por detalhes, uma pessoa para quem cada problema era uma crise em potencial. Sua equipe o admirava e literalmente via-o de baixo para cima, porque Carpenter era um homem gigantesco, com l,93m de altura e quase 150kg.

Gretchen Liu, a diretora de relações públicas, estava sentada no extremo esquerdo, na última fila de consoles. Jack a viu se vi­rar e dar aos espectadores um sorriso tranquilizador. Estava ves­tida em seu melhor traje para aparecer na TV, um terno azul-marinho e uma estola de seda cinza. Aquela missão chamara a atenção do mundo e, embora a maior parte da imprensa estivesse reunida no local de lançamento em Cabo Canaveral, havia repórteres o bastante no controle da missão do Centro Espacial John­son para lotar o auditório de observadores.

A interrupção de dez minutos da contagem regressiva terminou. No áudio, ouviram a aprovação definitiva da meteorologia, e a contagem recomeçou. Jack inclinou-se para a frente, múscu­los tensos à medida que a hora do lançamento se aproximava. A velha febre dos lançamentos estava de volta. Há um ano, quando se afastara do programa espacial, achava ter deixado tudo aquilo para trás. Mas lá estava ele, novamente tomado de excitação.

O sonho. Ele imaginou a tripulação afivelada aos seus assentos, o veículo estremecendo à medida que as câmaras de oxigênio e hidrogênio líquido eram pressurizadas. Pensou em sua claus­trofobia ao fecharem os visores. No sibilar do oxigênio. No dispa­rar de seus pulsos.

—Temos ignição dos SRB — disse o diretor de relações públicas no Controle de Lançamento do KSC. — E lançamento! Temos lançamento! O controle agora passa para o JSC de Houston...

Na tela principal, todos acompanhavam o curso do ônibus espacial, que se arqueava para leste, de acordo com o plano de vôo estipulado. Jack ainda estava tenso, o pulso acelerado. Nas telas de TV montadas no auditório, imagens do ônibus espacial eram transmitidas do KSC. As comunicações entre o Capcom e o comandante do ônibus espacial Kittredge eram ouvidas nos alto-falantes. A Discoverycomeçava a rodar enquanto alcançava as ca­madas superiores da atmosfera, onde o céu azul logo se converte­ria na escuridão do espaço.

—Estamos indo bem — disse Gretchen no circuito de áudio para a imprensa.

Em sua voz, todos ouviram o triunfo de um lançamento perfeito. E, até agora, fora perfeito. Haviam passado pelo ponto de Max Q, pela separação dos SRB, pelo desligamento dos motores principais.

No FCR, o diretor de voo Carpenter ficou imóvel, olhos fixos na tela principal.

—Discovery,autorizado separação do ET — disse o Capcom.

—Entendido, Houston — disse Kittredge. — Separação do ET completada.

Foi o súbito erguer da volumosa cabeça de Carpenter que disse para Jack que estava acontecendo algo incomum. No FCR, um surto de atividade pareceu animar todos os controladores de voo ao mesmo tempo. Diversos deles olhavam de esguelha para Car­penter, cujos ombros geralmente relaxados estavam agora tensos de atenção. Gretchen pressionava o fone de ouvido enquanto ou­via atentamente as transmissões.

Algo está errado, pensou Jack.

As comunicações terra-ar continuavam a ser ouvidas no auditório.

—Discovery — disse o Capcom — MMACS, indica que portas umbilicais não se fecharam. Por favor, confirme.

—Entendido. Confirmado. As portas não estão se fechando.

—Sugiro que passe ao comando manual.

Houve um silêncio terrível e então ouviram Kittredge dizer:

Houston, tudo bem agora. As portas acabaram de fechar.

Somente então, quando suspirou profundamente, Jack deu-se conta de que estava prendendo a respiração. Até então, aquela fora a única pequena falha. Tudo o mais, pensou, estava perfeito. Contudo, os efeitos da adrenalina ainda perduravam e suas mãos estavam suadas. Acabavam de receber uma advertência de que muitas coisas podiam dar errado, e ele não conseguia afastar esta nova sensação de inquietude.

Jack olhou para o FCR e perguntou-se se Randy Carpenter, o melhor dos melhores, tinha o mesmo pressentimento.

 

4 de agosto

Era como se o relógio em seu cérebro tivesse sido automaticamente reprogramado, alterando o seu ciclo de sono e de vigília, de modo que sua mente despertasse à 1 hora. Jack ficou deitado, olhos bem abertos, olhando para o mostruário do despertador. Assim como o ônibus espacial Discovery,pensou, estou tentan­do alcançar a ISS. Alcançar Emma. Seu corpo já estava sincroni­zado com o dela. Dali a uma hora ela acordaria e começaria o seu dia de trabalho. E lá estava Jack, já desperto, seus ritmos quase paralelos.

Ele não tentou voltar a dormir. Em vez disso, levantou-se e se vestiu.

À 1h30, o Controle da Missão estava fervilhando de ativida­de. Primeiro olhou para o FCR, onde sentavam os controladores do ônibus espacial. Até então, nenhuma crise ocorrera a bordo da Discovery.

Ele desceu o corredor rumo às Operações de Veículo Espe­cial, a sala de controle da ISS. Era muito menor que a FCR do ônibus espacial, mas contava com pessoal e fileiras de consoles exclusivas. Jack foi direto ao console do cirurgião de voo e afun­dou na cadeira ao lado de Roy Bloomfeld, o médico de plantão. Bloomfeld olhou para ele, surpreso.

—Ei, Jack. Estou vendo que você realmente voltou ao programa.

—Não consigo ficar longe.

—Bem, não pode ser pelo dinheiro. Portanto, tem de ser pela emoção. — Ele se recostou, bocejando. — Hoje à noite não tem havido muita emoção.

—O paciente está estável?

—Tem estado nas últimas 24 horas. — Bloomfeld inclinou a cabeça em direção às leituras da biotelemetria no seu console. O ECG e as leituras de pressão arterial de Kenichi Hirai piscavam na tela. — O ritmo está firme como uma rocha.

—Nenhum desdobramento?

—O último boletim foi há quatro horas. A dor de cabeça está pior, e ele ainda tem febre. Os antibióticos não parecem estar adiantando. Estamos todos intrigados.

Emma tem alguma ideia?

—À essa altura, ela provavelmente está exausta demais para pensar. Disse-lhe para dormir um pouco, uma vez que estamos monitorando o paciente. Até agora, tem sido bastante tedioso. — Bloomfeld bocejou outra vez. — Ouça, preciso ir ao banheiro. Poderia olhar o console para mim por alguns minutos?

—Sem problemas.

Bloomfeld saiu da sala, e Jack pôs os fones de ouvido.

Sentia-se em casa ao ver-se outra vez diante de um console. Ouvir a conversa abafada dos outros controladores, observar a tela principal, onde a rota da estação orbital era traçada em uma onda sinuosa sobre um mapa-múndi. Podia não ser um lugar no ônibus espacial, mas era o mais perto que conseguiria chegar. Ja­mais tocarei as estrelas, mas posso estar aqui e ver outros fazê-lo. Foi uma revelação surpreendente o fato de ter aceitado aquela amar­ga reviravolta em sua vida. O fato de poder estar na periferia de seu antigo sonho e ainda admirá-lo ao longe.

Seu olhar voltou-se para o ECG de Kenichi Hirai, e ele se inclinou para a frente. A linha oscilou rapidamente e, então, trans­formou-se em uma linha completamente reta no topo da tela.

Jack relaxou. Não havia com o que se preocupar. Entendeu aquilo como uma anomalia elétrica, provavelmente um contato solto do ECG. O marcador de pressão arterial continuava a pul­sar na tela, sem alterações. Talvez o paciente tivesse se movimen­tado e acidentalmente arrancado um contato. Ou Emma tivesse desconectado o monitor, para permitir que ele usasse o toalete em privacidade. Agora, a pressão arterial era cortada abrupta­mente, outra indicação de que Kenichi estava desconectado dos monitores. Olhou as telas mais um instante, esperando que as leituras voltassem a aparecer.

Quando isso não aconteceu, ele entrou no circuito de comunicação:

Capcom, aqui é o cirurgião. Estou detectando um padrão de contatos soltos no ECG do paciente.

—Contatos soltos?

—Parece ter sido desconectado do monitor. Não vejo a linha do coração. Poderia falar com Emma para confirmar?

—Entendido, cirurgião. Vou chamá-la.

Um gemido suave tirou Emma de seu sono sem sonhos, e ela despertou com o beijo frio da umidade em seu rosto. Não preten­dia cochilar. Embora o controle da missão estivesse monitorando continuamente o ECG de Kenichi pela biotelemetria e a alertasse em caso de alguma alteração, pretendera ficar desperta durante o período de sono da tripulação. Contudo, nos últimos dois dias tivera apenas breves períodos de descanso, que eram frequente­mente interrompidos por colegas tripulantes, despertando-a com perguntas sobre as condições do paciente. A exaustão e o extremo relaxamento que a falta de gravidade causara finalmente a pega­ram. Sua última lembrança era a de estar observando o ritmo cardíaco de Kenichi piscando na tela em uma linha hipnótica, a linha se transformando em uma mancha verde borrada. Depois, tudo escureceu.

Ciente da água fria contra seu rosto, ela abriu os olhos e viu um glóbulo flutuar em sua direção, rodopiando em um arco-íris de reflexos. Demorou alguns segundos até compreender para o que estava olhando, outros segundos para registrar dezenas de outros glóbulos dançando como ornamentos natalinos prateados ao seu redor.

Estática. Então uma voz irrompeu em sua unidade de comunicação:

—Hã, Watson, aqui é Capcom. Detestamos ter de despertá- la, mas precisamos confirmar a situação dos contatos de ECG do paciente.

Exausta, Emma respondeu:

—Estou acordada, Capcom. Eu acho.

—A biotelemetria mostra uma anomalia no ECG de seu paciente. O cirurgião acha que há algum contato solto.

Ela estivera flutuando, rodopiando no ar enquanto dormia. Agora, se reorientava no módulo, voltando-se para onde o paciente devia estar.

O saco de dormir estava vazio. O tubo de intravenoso flutuava, a extremidade do cateter liberando gotículas de soro no ar. Os fios soltos dos eletrodos também flutuavam, emaranhados.

Imediatamente ela desligou a bomba de infusão e olhou em torno.

—Capcom, ele não está aqui. Ele deixou o módulo! Espere.

Ela pegou impulso na parede e foi em direção ao Nodo 2, que levava aos laboratórios da NASDA e da ESA. Bastou olhar pela escotilha para ver que ele não estava ali.

—Você o localizou? — perguntou o Capcom.

—Negativo. Ainda procurando.

Teria ficado desorientado e estaria vagando confuso pela estação?

Voltando ao laboratório dos EUA, Emma atravessou a escotilha do nodo. Uma gota roçou-lhe a face. Ela a tocou com a mão e surpreendeu-se ao ver o dedo manchado de sangue.

—Capcom, ele atravessou o Nodo 1. Está sangrando por causa da picada da intravenosa.

—Recomendo que feche o fluxo de ar entre os módulos.

—Entendido.

Ela atravessou a escotilha do módulo habitacional. As luzes haviam sido amenizadas e, em meio à penumbra, viu Griggs e Luther, ambos profundamente adormecidos, fechados em seus sacos de dormir. Nada de Kenichi.

Não entre em pânico, pensou, antes de fechar o fluxo de ar entre os módulos. Pense. Para onde ele iria?

De volta à sua própria estação-dormitório, na extremidade russa da ISS.

Sem despertar Griggs ou Luther, ela deixou o módulo habitacional e atravessou com rapidez o túnel de nodos e módulos, o olhar voltando-se da esquerda para a direita em busca do pacien­te fugitivo.

Capcom, ainda não o localizei. Estou em Zarya indo em direção ao RSM.

Ela entrou no módulo de serviço russo, onde Kenichi normalmente dormia. Na penumbra, viu Diana e Nicolai, ambos adormecidos, flutuando como afogados, braços livres fora do saco de dormir. A estação de Kenichi estava vazia.

Sua ansiedade transformou-se em medo.

Ela cutucou Nicolai. Ele demorou a despertar, e mesmo depois de abrir os olhos, demorou um instante até compreender o que ela estava lhe dizendo.

—Não consigo encontrar Kenichi — repetiu Emma. — Precisamos procurar em todos os módulos.

Watson — disse o Capcom em seu fone de ouvido. — A engenharia informa anomalia intermitente na câmara de ar do Nodo 1. Favor verificar.

—Qual anomalia?

—Leituras positivas e negativas indicam que a escotilha entre a câmara de equipamentos e a de tripulantes pode não estar fe­chada direito.

Kenichi. Ele está na câmara de ar.

Com Nicolai logo atrás, ela voou como um pássaro através da estação e entrou no Nodo 1. Ao olhar pela primeira vez através da escotilha aberta, para a câmara de equipamentos, Emma viu o que lhe pareciam ser três corpos. Dois eram apenas o par de trajes de EVA, duras carapaças pendurados nas paredes da câmara de ar para poderem ser facilmente vestidas.

Pairando no ar, o corpo arqueado para trás em um espasmo convulsivo, estava Kenichi.

—Ajude-me a tirá-lo daqui! — exclamou Emma.

Ela foi para trás dele e, fixando o pé na escotilha externa, empurrou-o em direção a Nicolai, que o tirou da câmara pressuriza­da. Juntos, empurraram-no em direção ao módulo do laborató­rio, onde o equipamento médico fora montado.

Capcom, localizamos o paciente — disse Emma. — Parece estar tendo convulsões epiléticas. Preciso falar com o cirurgião!

—Espere, Watson. Prossiga, cirurgião.

Emma ouviu uma voz incrivelmente familiar ao fone de ouvido.

—Ei, Em. Ouvi dizer que está com um problema aí em cima.

—Jack? O que está fazendo...?

Como está o paciente?

Ainda atônita, ela concentrou a atenção em Kenichi. Mesmo enquanto reaplicar as intravenosas e os contatos de ECG, perguntava-se o que Jack estaria fazendo no controle da missão. Ele não se sentava em um console de cirurgião de vôo havia mais de um ano e agora lá estava ele ao comunicador, voz calma, enquan­to perguntava por Kenichi.

—Ainda está tendo convulsões?

—Não. Está fazendo movimentos deliberados agora, lutando contra nós...

Sinais vitais?

—O pulso está acelerado, 120,130. Peito ofegante.

—Bom. Então está respirando.

—Estamos ligando o ECG agora. — Ela olhou para o ritmo cardíaco na tela do monitor. — Taquicardia sinusal, taxa de 124. Ocasionais contrações preventriculares.

—Estou vendo na biotelemetria.

—Tomando a pressão arterial agora... — Emma levantou a manga do paciente e auscultou o pulso braquial à medida que a pres­são era lentamente liberada. — É 9,5 por 6. Nada significativo.

O golpe a pegou de surpresa. Emma emitiu um grito agudo de dor quando a mão de Kenichi a atingiu na boca. O impacto a fez se afastar e ela voou através do módulo, colidindo com a pa­rede oposta.

—Emma? — chamou Jack. — Emma?

Entontecida, ela tocou o lábio dolorido.

—Você está sangrando! — exclamou Nicolai.

No fone de ouvido, Jack perguntava, angustiado:

—O que diabos está acontecendo aí em cima?

—Estou bem — murmurou ela. E repetiu, irritada: — Estou bem, Jack. Não se altere.

Mas sua cabeça ainda estava zumbindo por causa do golpe. Enquanto Nicolai amarrava Kenichi à maca de contenção de pa­ciente, Emma ficou mais atrás, esperando passar a tontura e, a princípio, não registrou o que Nicolai estava dizendo.

Então, viu descrença nos olhos do colega.

—Olhe para o estômago dele — murmurou Nicolai. — Olhe!

Emma se aproximou.

—Que diabo é isso? — sussurrou ela.

—Fale comigo, Emma — disse Jack. — Diga-me o que está acontecendo.

Ela olhou para o abdome de Kenichi, que parecia ondular e fervilhar.

—Há algo se movendo... sob a pele dele...

—Como assim, se movendo?

—Parecem fasciculações. Mas está migrando através da barriga...

—Não é peristaltismo?

—Não. Está subindo. Não está seguindo o trato intestinal.

Ela se calou. A movimentação parou subitamente, e o abdome de Kenichi voltou a ser uma superfície macia, sem alterações.

Fasciculações, pensou Emma. Espasmos desordenados de fibras musculares. Era a explicação mais plausível, com exceção de um detalhe: fasciculações não migram em ondas.

Os olhos de Kenichi abriram-se de repente, e ele olhou para Emma.

O alarme cardíaco disparou. Emma voltou-se para ver a linha do ECG na tela.

Taquicardia ventricular! — exclamou Jack.

—Estou vendo, estou vendo! — Ela apertou o botão de carga do desfibrilador, então sentiu o pulso da carótida de Kenichi.

Ali estava. Tênue, quase imperceptível.

Os olhos do paciente se reviraram e somente a esclera vermelha era visível. Ele ainda respirava.

Emma posicionou os contatos do desfibrilador sobre o peito do paciente e apertou o botão de descarga. Uma carga elétrica de 100 joules atravessou o corpo de Kenichi.

Seus músculos se contraíam em espasmos violentos e simultâneos. Suas pernas golpeavam a maca. Apenas as correias evita­vam que ele saísse voando pelo módulo.

—Ainda com taquicardia ventricular! — exclamou Emma.

Diana entrou voando no módulo.

—O que posso fazer? — perguntou

—Prepare a lidocaína! — disse Emma. — Está na gaveta CDK, à direita.

—Encontrei.

—Ele não está respirando! — exclamou Nicolai.

Emma pegou o ventilador manual e disse:

—Nicolai, me segure!

Ele foi até a posição indicada, firmando os pés na parede oposta, as costas pressionadas contra as de Emma para firmá-la no lugar enquanto aplicava a máscara de oxigênio. Na Terra, uma ressuscitação cardiopulmonar é algo bastante complexo. Em um ambiente de microgravidade, era um pesadelo de complexas acrobacias, com equipamentos pairando ao redor, tubos se en­roscando no ar, seringas com drogas preciosas que se afastavam flutuando. O simples ato de pressionar as mãos contra o peito de um paciente podia fazê-lo sair voando pelo ar. Embora a tripula­ção tivesse sido treinada para uma situação assim, nenhum en­saio podia reproduzir o verdadeiro caos de corpos se movendo freneticamente em um espaço restrito, correndo contra o relógio de um coração moribundo.

Com a máscara sobre a boca e o nariz de Kenichi, ela apertou o ventilador manual, forçando o oxigênio a entrar nos pulmões. A linha do ECG continuava irrequieta.

—Administrada uma ampola de lidocaína intravenosa — disse Diana.

—Nicolai, outro choque! — exclamou Emma.

Após uma breve hesitação, ele pegou os contatos, posicio­nou-os no tórax e apertou o botão de descarga. Desta vez, 200 joules atingiram o coração de Kenichi.

Emma olhou para o monitor.

—Ele entrou em fibrilação ventricular! Nicolai, comece as compressões cardíacas. Vou entubá-lo!

Nicolai soltou os contatos do desfíbrilador, que começaram a flutuar, pendurados à ponta dos fios. Firmando-se à parede opos­ta do módulo, ele estava a ponto de pousar as mãos espalmadas sobre o esterno de Kenichi quando subitamente as afastou.

Emma olhou para ele.

—O que foi?

—O peito dele. Olhe para o peito!

Eles olharam.

A pele do peito de Kenichi fervilhava, retorcendo-se. Nos pontos onde os contatos do desfibriiador haviam disparado as suas cargas elétricas, haviam se formado dois círculos protuberantes que agora se espalhavam, corno ondulações provocadas por uma pedra atirada na água.

—Assistolia! — disse Jack ao fone de ouvido de Emma.

Nicolai ainda estava paralisado, olhando para o peito de Kenichi.

Foi Emma quem se posicionou, pressionando as costas con­tra as de Nicolai.

Assistolia. O coração parou. Sem as compressões cardíacas, ele vai morrer.

Ela não sentiu nada se movendo, nada incomum. Apenas pele esticada sobre ossos. Fasciculações musculares, pensou. Tem de ser. Não há outra explicação. Com o corpo em posição, Emma começou as compressões no tórax, mãos fazendo o trabalho do coração de Kenichi, bombeando sangue para seus órgãos vitais.

—Diana, uma ampola de epinefrina intravenosa! — ordenou.

Diana injetou a droga no tubo.

Todos olharam para o monitor, esperando, rezando por um bipe na tela.

 

- Tem de ser feita uma necropsia — disse Todd Cutler.

Gordon Obie, diretor de Operações de Tripulações de Vôo, lançou-lhe um olhar irritado. Alguns dos outros na sala de confe­rências também se irritaram, porque ele apenas dissera o óbvio. É claro que haveria uma necropsia.

Mais de uma dúzia de pessoas compareciam àquela reunião extraordinária. Uma autópsia era a menor de suas preocupações. No momento, Obie lidava com assuntos mais urgentes. Normal­mente um homem de poucas palavras, agora se via na desconfor­tável situação de ter microfones de repórteres enfiados em sua cara sempre que aparecia ena público. O doloroso processo de definir os culpados começara.

Obie tinha de aceitar uma porção de responsabilidade pela tragédia, porque aprovara a escolha dos membros da tripulação. Se a tripulação errara, ele também errara. E ter escolhido Emma Watson estava começando a parecer um grande erro.

Pelo menos era essa a mensagem que ouvia naquela sala. Como única médica a bordo da ISS, Emma Watson deveria ter se dado conta de que Hirai estava morrendo. Uma evacuação ime­diata no CRV poderia tê-lo salvado. Agora, um ônibus espacial fora lançado, e uma multimilionária missão de resgate se trans­formava em nada além de um transporte de cadáver. Washington estava ansiosa por bodes expiatórios, e a imprensa estrangeira fa­zia uma pergunta politicamente incendiária: será que eles deixa­riam morrer um astronauta americano?

O desastre de relações públicas era, na verdade, o assunto principal daquela discussão.

Gretchen Liu disse:

— O senador Parish fez uma declaração pública.

O diretor do JSC, Ken Blankenship resmungou:

—Tenho até medo de perguntar qual foi.

—A CNN de Atlanta mandou um fax dizendo: "Milhões de dólares de impostos foram usados no Veículo de Retorno de Tri­pulação. No entanto, a NASA preferiu não usá-lo. Tinham um homem doente em situação crítica lá em cima, cuja vida poderia ter sido salva. Agora, o bravo astronauta está morto e é evidente para todos que um erro terrível foi cometido. Uma morte no es­paço é inconcebível. Impõe-se uma investigação do Congresso." — Gretchen ergueu a cabeça com uma expressão grave. — Nosso senador favorito falando.

—Pergunto-me quantas pessoas se lembram que ele tentou vetar nosso programa do Veículo de Retorno da Tripulação — disse Blankenship. — Adoraria esfregar isso na cara dele agora.

—Não pode — disse Leroy Cornell.

Como administrador da NASA, cabia-lhe ponderar todas as implicações políticas. Ele era o contato com o Congresso e com a Casa Branca e nunca perdia de vista a noção de como as coisas aconteciam em Washington.

—Atacar um senador diretamente é atirar merda no ventilador.

—Ele está nos atacando.

—Não há nada de novo nisso. Todo mundo sabe.

—O público não sabe — disse Gretchen. — Ele está ganhando as manchetes com esses ataques.

—Esse é o problema: o senador quer as manchetes — disse Cornell. — Se nós contra-atacarmos, vamos alimentar a besta da mídia. Veja, Parish nunca foi nosso apoio. Foi contra todo au­mento de orçamento que pedimos. Ele quer comprar navios de guerra, não espaçonaves, e jamais mudaremos a opinião dele. — Cornell inspirou profundamente e olhou ao redor na sala. — En­tão seria bom prestar atenção nas críticas que ele faz e nos per­guntarmos se não são justificadas.

A sala ficou em silêncio um instante.

—Obviamente cometemos erros — disse Blankenship. — Erros de avaliação médica. Por que não sabíamos quão doente ele estava?

Obie viu os dois cirurgiões de voo trocarem olhares inquie­tos. Todos estavam concentrados no desempenho da equipe médica. E em Emma Watson.

Ela não estava ali para se defender. Obie teria de falar em seu nome.

Todd Cutler se antecipou:

Watson estava em desvantagem lá em cima. Qualquer médico estaria — disse ele. — Sem radiografia, sem sala de cirurgia. A verdade é que nenhum de nós sabe por que Hirai morreu. É por isso que precisamos de uma necropsia. Precisamos saber o que deu errado e se a microgravidade foi um fator que contribuiu para isso.

—Nenhum problema quanto a uma necropsia — disse Blankenship. — Todos concordamos que deve ser feita.

—Não, o motivo de ter mencionado isso é por causa do... — Cutler baixou a voz — do problema da preservação.

Houve uma pausa. Obie viu os olhares baixarem, todos incomodados com o significado daquelas palavras.

—Estamos falando da falta de refrigeração na estação — dis­se Obie. — Não temos nada para refrigerar algo tão grande como um corpo humano. Não em um ambiente pressurizado.

Woody Ellis, diretor de Voo da ISS disse:

—O encontro com o ônibus espacial será em 17 horas. Quanto o corpo pode se deteriorar neste tempo?

—Também não há refrigeração a bordo do ônibus espacial — destacou Cutler.—A morte ocorreu há sete horas. Acrescente a isso o tempo gasto na acoplagem, na transferência do corpo, assim como de outras cargas, na desacoplagem. Estamos falando ao menos de três dias com o corpo em temperatura ambiente. E isso se tudo cor­rer dentro do prazo. O que, como todos sabemos, não é certo.

Três dias. Obie pensou no que podia acontecer com um cadáver em dois dias. Em como pedaços de galinha fediam caso fos­sem deixados uma única noite na lixeira...

—Está me dizendo que a Discoverynão pode atrasar a volta à Terra nem mesmo em um dia? — perguntou Ellis. — Esperáva­mos que tivéssemos tempo para executar outras tarefas. Há di­versas experiências na ISS prontas para voltarem para casa. Os cientistas em terra estão esperando por isso.

—Uma necropsia não vai ajudar muito se o corpo se deteriorar — disse Cutler.

—Não há algum meio de preservá-lo? Embalsamá-lo?

—Não sem afetar a sua química. Precisamos de um corpo não embalsamado. E precisamos dele logo.

Ellis suspirou.

—Tem de haver um meio-termo. Um modo de fazerem alguma coisa enquanto estiverem acoplados.

Gretchen disse:

—Do ponto de vista das relações públicas, não é bom cuidar de assuntos triviais enquanto há um corpo na coberta. Afora isso, não há alguns... bem, riscos para a saúde? Há, também... o cheiro.

—O corpo está lacrado em um saco plástico — disse Cutler. — Podem escondê-lo atrás de uma cortina em uma estação-dormitório.

O assunto estava ficando tão mórbido que a maioria dos ros­tos na sala estava pálida. Podiam falar de desastre político e crise com a mídia. Podiam falar sobre senadores hostis e anomalias mecânicas. Mas cadáveres e fedor de carne deteriorada eram coi­sas nas quais não queriam se deter.

Leroy Cornell finalmente rompeu o silêncio.

—Compreendo a sua urgência em levar o corpo para necropsia, Dr. Cutler. E também compreendo o ponto de vista das relações públicas. A aparente... falta de sensibilidade caso faça­mos nosso trabalho nessas circunstâncias. Mas há coisas que pre­cisamos fazer, mesmo diante de nossas perdas. — Ele olhou para todos ao redor da mesa. — Não é este o nosso objetivo principal? Uma de nossas forças como organização? Não importa o que dê errado, não importa o que soframos, sempre lutamos para fazer o nosso trabalho.

Nesse momento, Obie sentiu uma súbita mudança de humor no ambiente. Até então, trabalhavam sob o impacto da tragédia, da pressão da mídia. Ele vira abatimento e derrota naqueles ros­tos. E auto-defesa. Agora, o choque se dissipava. Olhou para Cor­nell e sentiu diminuir um pouco do desdém que sentia por aque­le sujeito. Obie nunca confiara em gente de fala mansa como Cornell. Ele achava os administradores da NASA um mal neces­sário e os tolerava apenas enquanto mantivessem o nariz fora das decisões operacionais.

Às vezes, Cornell avançava o sinal. Hoje, porém, fizera-lhes um favor obrigando-os recuar e ver o quadro em uma perspecti­va mais ampla. Cada um viera para aquele encontro com suas preocupações particulares. Cutler queria um cadáver fresco para necropsia. Gretchen Liu queria a coisa certa para dizer à impren­sa. A equipe de administração do ônibus espacial queria expandir a missão da Discovery.

Cornell acabara de lembrá-los que tinham de olhar para além daquela morte, para além de suas preocupações individuais e se concentrarem no que era melhor para o programa espacial.

Obie meneou levemente a cabeça, concordando, o que foi notado por outros à mesa. A Esfinge finalmente demonstrara a sua opinião.

—Todo lançamento bem-sucedido é uma dádiva do céu — disse ele. — Não desperdicemos este.

 

5 de agosto

Morto.

Os tênis de corrida de Emma golpeavam ritmicamente a esteira do TVIS, e cada toque das solas de seus calçados contra a esteira, cada impacto contra seus ossos, juntas e músculos era ou­tro golpe de autopunição.

Morto.

Eu o perdi. Fiz tudo errado e o perdi.

Devia ter me dado conta de quão doente ele estava. Devia ter forçado um resgate no CRV. Mas eu o adiei, porque achei que podia cuidar disso. Achei que poderia mantê-lo vivo.

Com músculos doloridos, suor porejando na testa, ela continuou a se punir, enfurecida com o próprio fracasso. Ela não usa­va o TVIS havia três dias porque estivera muito ocupada cuidando de Kenichi. Para recuperar o tempo perdido, atara-se à lateral do aparelho, ligara a esteira e começara a correr.

Na Terra ela adorava correr. Não era tão rápida, mas desenvolvera resistência e aprendera a ingressar naquele transe hipnó­tico que acomete os fundistas, à medida que os quilômetros se desfazem sob seus pés, quando a dor dos músculos dá lugar à euforia. Dia após dia ela trabalhara para obter aquela resistência, forçara-se, teimosamente, a correr mais tempo, ir mais longe, sempre competindo com a última corrida, nunca sendo condes­cendente. Sempre fora assim desde menina; menor que as outras, embora mais determinada. Sempre fora exigente em sua vida, mas nunca mais do que fora para si mesma.

Errei. Agora meu paciente está morto.

O suor encharcava sua camisa, uma grande mancha de umidade espalhando-se entre seus seios. Suas coxas e panturrilhas estavam além do estágio da dor. Os músculos já estavam se con­traindo, à beira do colapso pela constante tensão.

Alguém desligou o interruptor do TVIS.

A esteira subitamente parou. Ela ergueu a cabeça e viu que Luther olhava para ela.

—Acho que já basta, Watson — murmurou.

—Ainda não.

Está aqui há mais de três horas.

Só estou aquecendo — murmurou, mal-humorada.

Ela acionou o interruptor e mais uma vez se pôs a correr sobre a esteira.

Luther observou um instante, flutuando ao nível dos olhos dela, sem desviar o olhar. Ela odiava ser analisada e chegou a odiá-lo naquele instante, porque achou que ele podia ver através de sua dor, de sua decepção consigo mesma.

—Não seria mais rápido se batesse a cabeça contra a parede? — perguntou Luther.

—Mais rápido. Mas não doloroso o bastante.

—Entendi. Para ser punição, tem de doer, certo?

—Certo.

—Faria alguma diferença se eu dissesse que isso é uma besteira? Porque de fato é. É perda de energia. Kenichi morreu por­que ficou doente.

—Era aí que eu devia entrar.

—E você não pôde salvá-lo. Então agora é a incompetente da corporação, hein?

—Certo.

—Bem, está errada. Porque eu reclamei este título antes de você.

—Isso é algum tipo de competição?

Outra vez ele desligou a TVIS. Outra vez a esteira parou. Ele olhava diretamente para os olhos dela e estava furioso. Tão furio­sa quanto ela.

—Lembra quando me ferrei? No Columbia?

Ela não respondeu. Não precisava.

Todos na NASA se lembravam. Acontecera havia quatro anos, durante uma missão de reparo a um satélite de comunica­ção. Luther era o especialista da missão responsável por reativar o satélite após o fim dos reparos. A tripulação o ejetou de seu berço na área de carga útil e observou-o se afastar. Os foguetes entraram em ignição na hora programada, enviando o satélite para a altitude correta, onde ele não respondeu a qualquer co­mando. Estava morto em órbita, um pedaço de ferro-velho de muitos milhões de dólares circulando a Terra inutilmente.

Quem foi o responsável por tal calamidade?

Quase imediatamente, a culpa recaiu sobre os ombros de Luther Ames. Na sua pressa de reativar o satélite, ele esquecera de digitar códigos de programação vitais. Ou essa foi a alegação do cliente do setor privado. Luther insistiu que digitara os códi­gos, que estava sendo usado como bode expiatório por conta de erros cometidos pelo fabricante do satélite. Embora o público tivesse ouvido muito pouco da controvérsia, dentro da NASA a história era bem conhecida. Luther não foi mais escalado. Foi condenado à categoria de astronauta fantasma, ainda na corpo­ração, mas invisível para os que escolhiam as tripulações do ôni­bus espacial.

Para complicar tudo, havia o fato de Luther ser negro.

Durante três anos, ele sofreu na obscuridade, seu ressentimento se acumulando. Apenas o apoio de amigos mais próxi­mos entre os outros astronautas — Emma mais que todos — o mantivera na corporação. Sabia não ter cometido erros, mas poucos na NASA acreditavam nele. Ele sabia que as pessoas fala­vam às suas costas. Luther era o homem que os racistas aponta­vam como prova de que as minorias não têm as qualidades dos "eleitos". Ele lutara para manter sua dignidade, embora às vezes se sentisse desesperado.

Então, a verdade veio à tona. O satélite estava com defeito. Luther Ames foi oficialmente absolvido de culpa. Em uma sema­na, Gordon Obie ofereceu-lhe uma missão, uma missão de qua­tro meses a bordo da ISS. Mas, mesmo agora, Luther ainda sentia a mancha duradoura em sua reputação. Ele sabia, dolorosamen­te, o que Emma estava sentindo.

Ele a encarou bem de perto, forçando-a a olhar para ele.

—Você não é perfeita, está bem? Todos somos humanos.

Ele fez uma pausa e acrescentou a seguir, secamente:

—Talvez com exceção de Diana Estes.

Contra a vontade, ela riu.

—Acabou a punição. Hora de se mexer, Watson.

A respiração de Emma voltara ao normal, embora seu cora­ção continuasse acelerado, porque ainda estava furiosa consigo mesma. Mas Luther estava certo, ela tinha de prosseguir. Era hora de lidar com as consequências de seus erros. Ainda seria preciso enviar um relatório final para Houston. Resumo médico, históri­co clínico. Diagnóstico. Causa da morte.

Médica incompetente.

A Discoveryacoplará em duas horas — disse Luther. — Você tem trabalho a fazer.

Após um instante, ela assentiu e livrou-se das correias de contenção do TVIS.

Hora de trabalhar, o rabecão está vindo aí.

 

7 de agosto

O corpo amarrado, lacrado em sua mortalha, rodopiava lentamente em meio à penumbra. Cercado pela desordem de excesso de equipamento e tubos de lítio vazios, o corpo de Kenichi era como mais uma peça desnecessária da estação descartada na cáp­sula Soyuz. A Soyuz não estava operando havia mais de um ano, e a tripulação da estação usava seu compartimento de serviço como espaço de armazenamento de refugos. Parecia um terrível insulto Kenichi estar ali, mas a tripulação ficara muita abalada com a sua morte. Ser confrontado repetidamente com seu corpo, flutuando em um dos módulos onde trabalhavam ou dormiam, teria sido muito perturbador.

Emma voltou-se para o comandante Kittredge e para o médico O'Leary do ônibus espacial Discovery.

—Lacrei o corpo imediatamente após a morte — disse ela. — Não foi tocado desde então.

Ela parou de falar e voltou o olhar para o cadáver. A mortalha era negra, e as pequenas e protuberantes bolhas plásticas que a recobriam não permitiam que adivinhassem as formas do corpo humano que envolvia.

—Os tubos ainda estão conectados? — perguntou O'Leary.

—Sim. Duas intravenosas, a sonda endotraqueal, e a nasogástrica. — Emma não mexera em nada, pois sabia que os pato­logistas que fariam a necropsia desejariam que tudo estivesse no lugar. — Vocês têm todas as culturas de sangue, todos os espéci­mes que recolhemos dele. Tudo.

Kittredge meneou a cabeça, soturno.

—Vamos lá.

Emma soltou a corda e tocou o corpo. Parecia duro, inchado, como se os tecidos já estivessem passando pela decomposição anaeróbia. Ela evitou pensar em como estaria o corpo de Kenichi sob a película de plástico escuro.

Foi uma procissão silenciosa, tão lúgubre quanto um cortejo fúnebre, os acompanhantes flutuando como espectros enquanto escoltavam o corpo através do longo túnel de módulos. Kittredge e O'Leary iam na frente, guiando o corpo através das escotilhas. Eram seguidos por Jill Hewitt e Andy Mercer, todos em silêncio. Quando o veículo orbital acoplara, havia um dia e meio, Kittred­ge e sua tripulação trouxeram sorrisos e abraços, maçãs e limões frescos, e a tão esperada edição de domingo do New York Times. Aquela era a antiga equipe de Emma, as pessoas com quem ela treinara durante um ano, e vê-los outra vez foi como uma reu­nião de família agridoce. Agora a reunião terminara e o último item a ser movido para bordo da Discoveryfazia o seu trajeto fantasmagórico em direção ao módulo de acoplagem.

Kittredge e O'Leary puxaram o corpo através das comportas até o convés intermediário da Discovery. Ali, o lugar onde a tripu­lação do ônibus espacial comia e dormia, ficaria o corpo até a aterrissagem. O'Leary o levou até um dos catres horizontais. An­tes do lançamento, aquele catre fora remodelado para servir como estação médica para o paciente adoentado. Agora, seria usado como ataúde temporário.

—Não está entrando — disse O'Leary. — Acho que o corpo está muito distendido. Foi exposto ao calor?

Ele olhou para Emma.

—Não. A temperatura da Soyuz foi mantida.

—Aqui está o problema — disse Jill. — A mortalha agarrou na abertura. — Ela estendeu a mão e soltou o plástico. — Tente agora. — Daquela vez o corpo entrou. O'Leary fechou o painel de privacidade do catre de modo que ninguém precisasse olhar para o seu ocupante.

Seguiu-se uma solene cerimônia de despedida entre as duas tripulações.

Kittredge abraçou Emma e murmurou:

—Na próxima missão, Watson, você será a minha primeira escolha.

Quando se separaram, ela estava chorando.

Tudo terminou na tradicional cerimônia de despedida entre os comandantes Kittredge e Griggs. Emma olhou pela última vez para a tripulação do veículo orbital — a sua tripulação — acenando-lhes adeus. Então, a escotilha se fechou. Embora a Discoverypermanecesse acoplada à ISS por mais 24 horas enquanto a tripulação descansava e se preparava para desacoplar, o fecha­mento daquelas escotilhas pressurizadas encerrava efetivamente qualquer contato humano entre eles. Estavam outra vez em veí­culos separados, temporariamente acoplados, como duas libélulas em uma dança de acasalamento no espaço.

A piloto Jill Hewitt estava com dificuldade para dormir.

A insónia era algo novo para ela. Até mesmo na noite anterior a um lançamento, conseguia dormir profundamente, confiando em uma vida inteira de boa sorte para ampará-la no dia seguinte. Orgulhava-se de nunca ter precisado de uma pílula para dormir. As pílulas eram para os neuróticos e obsessivos, que se preocupavam com milhares de coisas terríveis. Como piloto naval, Jill já tivera mais do que a parte que lhe cabia de perigo mortal. Voara sobre o Iraque, aterrissara um jato danificado em um porta-aviões em movimento, ejetara-se do avião sobre um mar tempestuoso. Achava ter enganado a morte tantas vezes que esta certamente desistira e voltara derrotada para casa. Portanto, ela geralmente dormia bem.

Naquela noite, porém, o sono não vinha. Era por causa do cadáver.

Ninguém quis ficar perto dele. Embora o painel de privacidade estivesse fechado, ocultando o corpo, todos sentiam a sua pre­sença. A morte entrara no seu espaço vital, lançara a sua sombra sobre o jantar, estragara suas piadas habituais. Era o indesejável quinto membro da tripulação.

Como para fugir daquilo, Kittredge, O'Leary e Mercer abandonaram as suas habituais estações de sono e foram para o con­vés superior. Apenas Jill permaneceu no convés intermediário, talvez para provar para os homens que ela era menos sensível que eles, que ela, uma mulher, não se incomodava com um cadáver.

Mas agora, com as luzes da cabine atenuadas, ela descobriu que o sono lhe fugia. Ela ficava pensando no que estava atrás daquele painel fechado. Pensava em Kenichi Hirai, quando era vivo.

Lembrava-se dele claramente como alguém pálido e de fala mansa, com cabelo negro rígido como arame. Certa vez, no trei­namento de ausência de peso, roçara-lhe o cabelo e surpreendera-se: pareciam pelos de javali de tão duros. Perguntou-se como ele estaria agora. Sentiu uma súbita e doentia curiosidade sobre como estaria o rosto dele, sobre as mudanças que a morte lhe impusera. Era a mesma curiosidade que a compelia, quando criança, a enfiar gravetos nos corpos de animais mortos que às vezes encontrava na floresta.

Decidiu afastar-se ainda mais do corpo.

Levou o saco de dormir para bombordo e prendeu-o atrás da escada de acesso ao convés superior. Era o mais longe que pode­ria ir, embora ainda estivessem no mesmo nível. Outra vez ela se fechou dentro do saco. No dia seguinte, precisaria de cada refle­xo, cada neurônio, para operar no máximo de sua capacidade durante o processo de reentrada e aterrissagem. Usando a sua força de vontade, obrigou-se a cair em um transe profundo.

Ela já estava dormindo quando o redemoinho de líquido iridescente começou a vazar da mortalha de Kenichi Hirai.

Começara com algumas gotículas brilhantes que vazaram através de um pequeno orifício no plástico, rasgado quando a mortalha prendera na abertura do catre. Durante horas, a pressão aumenta­ra, o plástico lentamente inflando enquanto o conteúdo inchava. Então, a brecha se alargara, e um fio bruxuleante começara a esca­par por ali. Vazando através dos orifícios de ventilação do catre, o fio se dividira em gotículas azul-esverdeadas que dançavam no ar antes de se agruparem em grandes glóbulos que pairavam na cabi­ne em penumbra. O fluido iridescente continuava a escapar. Os glóbulos se espalharam, levados pelas suaves correntes de ar. Atravessando a cabine, chegaram até Jill Hewitt, que dormia relaxada, sem se dar conta da nuvem brilhante que a envolvia, sem perceber a neblina que inalava a cada inspiração ou as gotículas que se acu­mulavam como condensação sobre seu rosto. Ela só se mexeu uma vez, para coçar uma das faces, e as gotículas iridescentes es­corregaram para perto de seus olhos.

Levadas pelas correntes de ar, as gotículas passaram através da abertura de acesso entre os conveses e começaram a se espalhar em meio à penumbra da cabine onde os três homens se en­tregavam ao relaxamento total do sono sem gravidade.

 

8 de agosto

Havia alguns dias, um redemoinho ameaçador co­meçara a se formar sobre o leste do Caribe. A princípio, era apenas uma depressão sinuosa na alta atmosfera, uma gentil ondulação de nuvens formadas pelas águas do mar equatorial evaporadas pelo sol. Chocando-se contra uma corren­te de ar mais fria vinda do norte, as nuvens começaram a rodar em torno de um sereno olho de ar seco. Agora, era uma espiral definida que parecia aumentar a cada nova imagem transmitida pelo satélite meteorológico GOES. O Serviço Meteorológico Nacional do NOAA a vinha rastreando desde o início. Observara-a vagar, sem direção, pela extremidade leste de Cuba. Agora, novas informações estavam sendo enviadas pelas bóias: medidas de temperatura, velocidade e direção dos ventos. Estas informações reforçavam o que os meteorologistas viam agora em suas telas de computador.

Era uma tempestade tropical. E movia-se para o noroeste, em direção à ponta da Flórida.

Aquele era o tipo de notícia que Randy Carpenter, diretor de voo do ônibus espacial, mais temia. Podiam contornar problemas de engenharia. Podiam se virar com múltiplas falhas de sistemas. Mas contra as forças da Mãe Natureza, nada podiam fazer. A preocupação principal daquele encontro matinal da equipe de administração da missão era a decisão de sair de órbita ou não. O desacoplamento e a queima de combustível para o ônibus espa­cial sair de órbita estavam programados para dali a seis horas. O boletim meteorológico mudara tudo.

—O grupo de meteorologia aeroespacial da NOAA informa que a tempestade tropical está se movendo para norte-nordeste, indo em direção às Keys da Flórida — disse o encarregado do boletim. — O radar da base aérea de Patrick e o NexRad Doppler do Serviço Nacional de Meteorologia em Melbourne indicam ventos radiais com velocidades superiores a 65 nós e chuva inten­sa. Os balões Rawinsonde e Jimsphere o confirmam. Do mesmo modo, tanto a rede Field Mill ao redor do Cabo Canaveral quan­to o LDAR demonstram aumento de atividade elétrica na atmos­fera. Estas condições provavelmente continuarão nas próximas 48 horas. Talvez mais.

—Em outras palavras, não aterrissaremos em Kennedy — concluiu Carpenter.

—Kennedy está definitivamente fora de questão. Ao menos pelos próximos três ou quatro dias. — suspirou Carpenter. — Muito bem, precisamos adivinhar o que vem por aí. Vamos ouvir notícias de Edwards.

A Base Aérea de Edwards, localizada em um vale a leste da Sierra Nevada, na Califórnia, não era a sua primeira escolha. Uma aterrissagem em Edwards atrasava o processamento e o preparo do ônibus espacial para a missão seguinte porque o veículo orbi­tal tinha de ser transportado de volta a Kennedy nas costas de um 747.

—Infelizmente, também temos um problema com Edwards — disse o meteorologista.

Carpenter sentiu um nó na boca do estômago. Uma premonição de que aquilo era o começo de uma sequência de aconteci­mentos ruins. Como principal diretor de vôo do ônibus espacial, tinha como missão pessoal registrar qualquer contratempo ocor­rido e analisar o que acontecera de errado. Com a vantagem da visão retrospectiva, ele geralmente conseguia rastrear o problema de trás para frente, através de uma sucessão de decisões ruins, embora aparentemente inócuas. Às vezes, tudo começava na fá­brica, com um técnico distraído, um painel mal conectado. Dia­bos, até mesmo algo grande e caro como as lentes do telescópio Hubble começara errado desde o início.

Agora, ele não conseguia afastar a sensação de que, mais tarde, refletiria sobre aquela mesma reunião onde estava e se per­guntaria: O que eu deveria ter feito de diferente? O que eu poderia ter feito para evitar a catástrofe?

—Quais as condições em Edwards?

—No momento o teto de nuvens está a 7 mil pés.

—Isso automaticamente inviabiliza a base.

— Certo. E venham me falar da ensolarada Califórnia. Mas há a possibilidade de ficar apenas parcialmente nublado nas próximas 24 ou 36 horas. Poderemos ter condições de aterrissagem razoáveis caso esperemos. Senão, teremos de optar pelo Novo México. Acabei de verificar com o MIDDS, e White Sands parece estar bem. Céu claro, ventos de proa entre 5 e 10 nós. Nenhuma previsão meteorológica adversa.

—Então, restam-nos as escolhas de esperar Edwards abrir ou ir para White Sands — disse Carpenter. E olhou em torno da sala para o resto de sua equipe em busca de opiniões.

Um dos administradores do programa disse:

—No momento, eles estão bem lá em cima. Podemos deixá- los acoplados à ISS o quanto precisarmos, até o tempo melhorar. Não vejo necessidade de apressar a volta deles para um lugar que seja menos que o ideal.

Menos que o ideal era um eufemismo. White Sands não passava de uma pista de pouso isolada equipada com cilindros de alinhamento de curso.

—Temos de trazer o corpo de volta o mais rápido possível — disse Todd Cutler. — Enquanto uma necropsia ainda é possível.

—Todos estamos cientes disso — disse o gerente do programa. — Mas pense nos inconvenientes: White Sands é limitada. Não há apoio médico civil nas redondezas caso tenhamos proble­mas na aterrissagem. Na verdade, somando tudo, sugiro que es­peremos até o tempo abrir em Kennedy. Logisticamente, é o me­lhor para o programa. Teremos um retorno mais rápido do veículo orbital e poderemos posicioná-lo de volta à plataforma para a próxima missão. No meio-tempo, a tripulação pode usar a ISS como hotel.

Diversos outros administradores de programa assentiram. Todos estavam assumindo a abordagem mais conservadora. A tripulação estava segura onde estava, a urgência de trazer o cor­po de Hirai diminuía à luz de todos os problemas de uma ater­rissagem em White Sands. Carpenter pensou em todos as formas que poderia vir a ser questionado no caso de, Deus o livrasse, fazerem uma aterrissagem catastrófica em White Sands. Pensou nas perguntas que faria caso estivesse revisando as decisões de outro diretor de vôo. Por que não esperou o tempo melhorar? Por que os trouxe de volta com tanta pressa?

A decisão certa era aquela que minimizava os riscos, embora atingisse os objetivos da missão.

Decidiu escolher o meio-termo.

—Três dias é tempo demais — disse ele. — Portanto, Kennedy está fora de questão. Vamos para Edwards. Talvez tenhamos céu claro amanhã. — Ele olhou para o meteorologista. — Faça essas nuvens desaparecerem.

—Claro. Farei uma dança da chuva ao contrário.

Carpenter olhou para o relógio na parede.

—Tudo bem. Daqui a quatro horas, quando a tripulação despertar, daremos a notícia de que ainda não poderão voltar para casa.

 

9 de agosto

Jill Hewitt acordou engasgada. Seu primeiro pensamento cons­ciente era que estava ficando asfixiada toda vez que respirava, como se estivesse inalando água.

Ela abriu os olhos e, em pânico, viu o que parecia ser um cardume de águas-vivas flutuando ao seu redor. Ela tossiu, final­mente conseguiu inspirar, e voltou a tossir. O ar expelido com força dispersou todas as águas-vivas que a cercavam.

Ela saiu do saco de dormir e ligou as luzes da cabine.

Atônita, olhou para o ar bruxuleante.

—Bob! — chamou. — Temos um vazamento!

Lá em cima, no convés superior, O'Leary gritou:

—Meu Deus, que diabo é isso?

—Usem as máscaras! — ordenou Kittredge. — Até termos certeza de que não é tóxico. — Jill abriu o armário de emergência, tirou o kit de proteção contra contaminação e jogou máscaras e óculos para Kittredge, O'Leary e Mercer quando estes desceram até o convés intermediário. Não houve tempo para se vestirem, todos ainda em roupas de baixo, ainda estremunhados.

Agora, já com as máscaras, olharam para os glóbulos azul- esverdeados que flutuavam ao seu redor.

Mercer estendeu a mão e capturou um deles.

—Estranho — disse ele, esfregando-o entre os dedos. — É grosso. Gosmento. Como algum tipo de muco.

O'Leary, o médico de bordo, capturou um dos glóbulos e levantou os óculos de proteção para olhá-lo de perto.

—Nem mesmo é líquido.

—Parece-me líquido — disse Jill. — Comporta-se como tal.

—Mas é mais gelatinoso. Quase como...

Todos se sobressaltaram quando uma música muito alta começou a tocar. Era Élvis Presley cantando "Blue Suede Shoes" com sua voz aveludada.

A chamada de despertar matinal do controle da missão.

—E um bom dia para vocês, Discovery — veio a voz alegre do Capcom. — Hora de acordar, pessoal!

Kittredge respondeu:

—Capcom, já estamos acordados. Estamos, hã... numa situação estranha aqui em cima.

—Estranha?

—Temos um tipo de vazamento na cabine. Estamos tentan­do identificar o que é. E uma substância viscosa, de um azul-esverdeado leitoso. Parecem pequenas opalas flutuantes. Já se espa­lhou por ambos os conveses.

—Estão usando máscaras?

—Afirmativo.

—Sabem de onde vêm?

—Nenhuma idéia.

—Muito bem, estamos consultando o ECLSS. Devem ter uma idéia do que seja.

—Seja o que for, não parece ser tóxico. Dormimos todos com esse negócio flutuando no ar. Nenhum de nós parece doen­te. —Kittredge olhou para a tripulação mascarada e todos menea­ram a cabeça afirmativamente.

—O vazamento tem algum cheiro? — perguntou o Capcom. — O ECLSS quer saber se pode ser do sistema de recolhimento de dejetos.

Jill sentiu-se nauseada. Era esse negócio que ela estava respirando? Um vazamento de dejetos sanitários?

—Hã... acho que um de nós terá de cheirar — disse Kittredge. Ele olhou para a tripulação, que simplesmente olhou de volta para ele. — Ei, pessoal, não se ofereceram todos de uma vez — murmurou antes de finalmente erguer a máscara; apertou um glóbulo entre os dedos e cheirou. — Não creio que seja esgoto. Nem nada químico. Ao menos, nenhum derivado de petróleo.

—Qual o cheiro? — perguntou Capcom.

—Cheira a... peixe. Como gosma de truta. Algo da cozinha, talvez?

—Ou pode ser um vazamento de uma das cargas úteis de seres vivos. Vocês estão transportando algumas experiências da ISS. Não há aquários a bordo?

—Esse troço me faz lembrar ovos de sapo. Vamos verificar os aquários — disse Kittredge, olhando em torno da cabine, para as massas brilhantes grudadas nas paredes. — Está assentando em tudo agora. Vai demorar para limparmos isso aqui. Vai atrasar a nossa reentrada.

—Hã, Discovery, detesto ser eu a dar a notícia — disse o Capcom. — Mas a reentrada vai atrasar de qualquer modo. Terão de esperar.

—Qual o problema?

—O tempo. Kennedy está enfrentando ventos cruzados de mais de 40 nós, com possibilidade de tempestades elétricas na vizinhança. Tempestade tropical vindo de sudeste. Já fez muito estrago na República Dominicana e avança para as Keys.

—E quanto a Edwards?

—Atualmente estão anunciando um teto de nuvens de mais de 7 mil pés. Deve melhorar nos próximos dois dias. Portanto, a não ser que vocês estejam ansiosos para pousar em White Sands, estamos prevendo um atraso de ao menos 36 horas. Talvez seja aconselhável reabrir as escotilhas e se juntarem à tripulação da ISS outra vez.

Kittredge olhou para os glóbulos flutuantes.

—Negativo, Capcom. Contaminaríamos a estação com esse vazamento. Temos de limpar esse negócio.

—Entendido. O cirurgião, que está aqui ao meu lado, quer confirmar se a sua tripulação não está sentindo qualquer efeito adverso. Isso é correto?

—O vazamento parece ser inofensivo. Ninguém demonstra sinais de doença. — Ele afastou um aglomerado de glóbulos, que se espalharam como pérolas. — São até bonitas. Mas detesto imaginá-las melando nossos equipamentos eletrônicos, de modo que é bom começarmos a cuidar da limpeza.

—Nós os atualizaremos sobre as mudanças do tempo, Discovery.Agora, peguem os baldes e os esfregões.

—É — riu Kittredge. — Chamem-nos de serviço de limpeza em altitude. Limpamos até janelas. — Ele tirou a máscara. — Acho que é seguro retirá-las.

Jill tirou a máscara e os óculos de proteção e flutuou até o armário de emergência. Havia acabado de guardar o equipamen­to quando viu Mercer olhando para ela.

—O que foi? — disse ela.

—Seu olho... o que aconteceu com ele?

—O que há de errado com meu olho?

—É melhor você dar uma olhada.

Ela foi até a estação de higiene.

Sua primeira visão no espelho foi chocante. A esclera de um de seus olhos estava vermelho-sangue. Não apenas rajada, mas tomada de um púrpura sólido.

—Meu Deus — murmurou, horrorizada com seu próprio reflexo. Sou piloto. Preciso de meus olhos. E um deles parece uma bolsa de sangue.

O'Leary tomou Jill pelos ombros, voltou-a e examinou o olho dela.

—Nada com o que se preocupar, está bem? — disse ele. — É apenas uma hemorragia da esclera.

—Apenas?

—Um pequeno sangramento no branco dos seus olhos. Pa­rece mais sério do que é de fato. Vai desaparecer, sem qualquer dano à sua visão.

—Como aconteceu?

—Mudanças súbitas na pressão intracraniana podem provo­car esse tipo de hemorragia. Às vezes, um ataque de tosse violento ou vomitar muito é o que basta para estourar um pequeno vaso sanguíneo.

Ela suspirou aliviada.

—Deve ser isso. Acordei sufocava com essa gosma flutuante.

—Viu? Nada com o que se preocupar. — Ele deu um tapinha no ombro de Jill. — São 50 dólares. Próximo paciente!

Mais tranquila, ela voltou-se para o espelho. É apenas um pequeno sangramento,pensou. Nada com o que se preocupar. Mas a imagem a horrorizava. Um olho normal, o outro de um verme­lho brilhante e maligno.

Algo alienígena. Satânico.

 

10 de agosto

—São uns convidados infernais — disse Luther. — Nós batemos a porta na cara deles, mas ainda assim se recusam a ir embora.

Todos na cozinha riram, até mesmo Emma. Nos últimos dias, o humor estivera em baixa a bordo da ISS, e foi um alívio ouvir as pessoas brincando de novo. Desde que haviam transferido o corpo de Kenichi para a Discovery,o humor de todos parecia ter melhorado.

O corpo amortalhado fora uma lúgubre e constante lembrança da morte, e Emma estava aliviada por não ter mais de se con­frontar com a evidência de seu próprio fracasso. Podia voltar a se concentrar em seu trabalho.

Ela conseguiu até rir da piada de Luther, embora o objeto de seu humor — o fracasso da partida do veículo orbital — não fos­se muito engraçado. Aquilo lhes complicara o dia. A Discovery deveria ter desacoplado cedo na manhã anterior. Agora já se ha­via passado um dia, e a nave ainda estava acoplada e não poderia partir nas próximas 12 horas pelo menos. Seu horário incerto de partida também alterou o horário de trabalho da estação. Desa­coplar era mais do que uma simples questão do veículo orbital se soltar por conta própria e se afastar. Era uma manobra delicada entre dois objetos imensos voando a mais de 28 mil quilômetros por hora e requeria cooperação tanto da tripulação do veículo orbital quanto da ISS. Durante a desacoplagem, o programa de controle da estação espacial tinha de ser temporariamente recon­figurado para as operações de proximidade, e sua tripulação ti­nha de suspender muitas de suas atividades de pesquisa. Todos tinham de estar concentrados na partida do veículo orbital, de modo a evitar uma calamidade.

Agora, um dia nublado sobre uma base da Força Aérea na Califórnia atrasara tudo, provocando o caos no horário de traba­lho da estação espacial. Mas esta era a natureza dos vôos espa­ciais: a única coisa previsível a seu respeito era o imprevisível.

Um glóbulo alarmante de suco de uva passou flutuando so­bre a cabeça de Emma. Aí está outra coisa imprevisível, pensou, rindo, enquanto um envergonhado Luther saía correndo atrás dele com um canudo. Você se distrai um instante, e lá se vai uma ferramenta vital ou um gole de suco. Sem gravidade, um objeto solto podia ir parar em qualquer lugar.

Era exatamente isso que a tripulação da Discoveryestava enfrentando naquele momento.

—Temos montes desse negócio em todos os nossos controles DAP de proa. — Ela ouviu Kittredge dizer pelo rádio. O coman­dante da Discovery conversava com Griggs no subsistema espaço-espaço. — Ainda estamos tentando limpar todas as nossas chaves de alternância, mas parece catarro grosso quando seca. Só espero que não tenha danificado nenhuma porta de dados.

—Descobriu de onde está vindo? — perguntou Griggs.

—Encontramos uma pequena fissura no aquário do peixe- sapo. Mas não parece ter vazado muita coisa. Não o bastante para ser o que estava flutuando na cabine.

—De onde mais pode estar vindo?

—Estamos verificando a cozinha e os armários agora. Estivemos tão ocupados limpando a cabine que não tivemos oportuni­dade de procurar a fonte. Não consigo identificar o que é esse ne­gócio. Isso me lembra ovos de sapo. Há umas bolotas dentro dessa massa verde pegajosa. Devia ver a minha tripulação. Estão cobertos de gosma, como no filme Os caça-fantasmas. E Hewitt está com aquele olho vermelho horrível. Cara, estamos feios de se ver.

Olho vermelho horrível? Emma voltou-se para Griggs.

—O que há de errado com o olho de Hewitt? — disse ela. — Não me falaram a esse respeito.

Griggs fez a pergunta à Discovery.

—E apenas um sangramento da esclera — respondeu Kittredge. — Nada sério, de acordo com O'Leary.

—Deixe-me falar com Kittredge — disse Emma.

—Vá em frente.

—Bob, aqui é Emma — disse ela. — O que provocou esse sangramento na esclera de Jill?

—Ontem, ela acordou tossindo. Achamos que foi isso.

—Ela está com dores abdominais ou de cabeça?

—Ela se queixou de uma leve dor de cabeça agora há pouco. E todos estamos com dores musculares. Mas temos trabalhado como burros de carga aqui.

—Náusea? Vômito?

—Mercer está com o estômago embrulhado. Por quê?

Kenichi também teve hemorragia na esclera.

—Mas isso não é grave — disse Kittredge. — Foi o que O'Leary disse.

—Não. E o somatório de sintomas que me preocupa — disse Emma. — A doença de Kenichi começou com vômitos e uma hemorragia escleral. Dores abdominais. Dor de cabeça.

—Está me dizendo que é algum tipo de contágio? Então por que não está doente? Você cuidou dele.

Era uma boa pergunta que ela não sabia como responder.

—De que doença estamos falando? — perguntou Kittredge.

—Eu não sei. O que sei é que Kenichi ficou incapacitado um dia após o início dos primeiros sintomas. Vocês precisam desacoplar e ir embora agora. Antes que alguém na Discoveryfique doente.

—Não é possível. Edwards ainda está coberta de nuvens.

—Então White Sands.

—Não é uma boa opção agora. Eles estão com um problema com um de seus TACAN. Ei, estamos bem. Vamos apenas espe­rar o tempo melhorar. Não deve durar mais de 24 horas.

Emma olhou para Griggs.

—Quero falar com Houston.

—Eles não vão mudar a aterrissagem para White Sands só porque Hewitt está com um olho vermelho.

—Pode ser mais que apenas uma hemorragia da esclera.

—E como pegaram a doença de Kenichi? Eles não foram expostos a ele.

O corpo, pensou Emma.O corpo está no veículo orbital.

—Bob — disse ela. — Aqui é Emma outra vez. Quero que verifique a mortalha.

—O quê?

—Verifique se há algum furo na mortalha de Kenichi.

—Você viu que estava bem selada.

—Tem certeza de que ainda está?

—Tudo bem — suspirou ele. — Tenho de admitir, não verificamos o corpo desde que veio para bordo. Acho que estávamos todos um tanto assustado com ele. Mantivemos o painel do catre fechado para não termos de olhar para ele.

—Como está a mortalha?

—Estou tentando abrir o painel agora. Parece estar agarran­do um pouco, mas...

Houve um silêncio. Então um murmúrio:

—Meu Deus!

—Bob?

—O vazamento vem da mortalha!

—O que é? Sangue, soro?

—Há um rasgão no plástico. Posso ver o vazamento!

O que estaria vazando?

Ouviu outras vozes ao fundo. Gemidos assustados e o som de alguém vomitando.

—Fechem. Fechem isso! — gritou Emma.

Mas eles não responderam.

Jill Hewitt disse:

—O corpo dele parece um purê. E como se estivesse... se dissolvendo. Precisamos descobrir o que está acontecendo.

—Não! — gritou Emma. — Discovery,não abram a mortalha!

Para seu alívio, Kittredge finalmente respondeu:

—Entendido, Watson. O'Leary, feche isso. Não vamos dei­xar mais desse... negócio... vazar.

—Talvez devêssemos ejetar o corpo — disse Jill.

—Não — respondeu Kittredge. — Eles o querem para necropsia.

—Que tipo de fluido é esse? — perguntou Emma. — Bob, responda!

Houve um silêncio. Então ele disse:

—Eu não sei. Mas seja o que for, espero que não seja infeccioso, pois todos fomos expostos.

Treze quilos de gordura e pelo. Assim era Humphrey, esparrama­do como um paxá sobre o peito de Jack. Este gato está tentando me matar, pensou Jack, olhando para os olhos verdes e malevo­lentes de Humphrey.

Ele adormecera no sofá e despertara com uma tonelada de gordura felina esmagando suas costelas, expelindo o ar para fora de seus pulmões.

Ronronando, Humphrey cravou uma unha no peito de Jack.

Com um grito, Jack o empurrou, e Humphrey caiu sobre as quatro patas num baque considerável.

—Vá caçar ratos — murmurou Jack, virando-se de lado para voltar a dormir.

Mas não adiantou. Humphrey começou a miar pedindo comida. Outra vez.

Bocejando, Jack se arrastou do sofá até a cozinha. Assim que abriu a despensa onde ficava a ração, Humphrey começou a miar mais alto. Jack encheu a vasilha com Little Friskies e observou, chateado, enquanto seu castigo comia. Eram 15 horas, e Jack ain­da não conseguira dormir. Estivera acordado a noite inteira, ocu­pando o console do cirurgião na sala de controle da estação espa­cial, e então voltara para casa e se sentara no sofá para rever os subsistemas ECLSS da estação espacial. Estava de volta ao jogo e gostava daquilo. Até mesmo de ler um árido manual de treinamento MOD. Mas a fadiga finalmente o venceu e ele acabou adormecendo perto do meio-dia, cercado de pilhas de manuais de voo.

O estômago de Humphrey já estava meio vazio. Inacreditável.

Quando Jack se voltou para sair da cozinha, o telefone tocou.

Era Todd Cutler.

—Estamos reunindo pessoal médico para receber a Discovery em White Sands — disse ele. — O avião deixará Ellington em trinta minutos.

—Por que White Sands? Achei que a Discovery ia esperar que o tempo abrisse em Edwards.

—Temos uma situação médica a bordo e não podemos espe­rar o tempo abrir. Vão sair de órbita em uma hora. Estamos tomando precauções contra uma infecção.

—Qual infecção?

—Ainda não foi identificada. Estamos apenas tomando precauções. Vem conosco?

—Sim, vou — disse Jack, sem hesitação.

—Então é bom vir rápido para não perder o avião.

—Espere. Quem é o paciente? Qual deles está doente?

—Todos eles — disse Cutler. — A tripulação inteira.

 

Precauções contra infecção. Saída de órbita de emer­gência. Com o que estamos lidando?

O vento soprava levantando poeira enquanto Jack corria pela pista em direção ao jato que o aguardava. Com olhos semicerrados por causa da poeira em suspensão, subiu os degraus e entrou no avião. Era um Gulfstream IV de 15 passageiros, um de uma frota de robustos e confiáveis burros de carga que a NASA usava para transportar o pessoal do ônibus espacial entre seus distantes centros de operações. Já havia 12 pessoas a bordo, incluindo um certo número de enfermeiras e médicos da Clínica de Medicina de Vôo. Diversos deles acenaram para Jack.

—Precisamos ir, senhor — disse o copiloto. — Assim, aperte o seu cinto de segurança, por favor.

Jack sentou-se junto a uma janela, na frente do avião.

Roy Bloomfeld foi o último a embarcar, cabelo ruivo-claro despenteado pelo vento. Assim que Bloomfeld se sentou, o copi­loto fechou a escotilha.

—Todd não vem? — perguntou Jack.

—Ele está no console, para controlar a aterrissagem. Parece que nós seremos a tropa de choque.

O avião começou a taxiar na pista. Não tinham tempo a perder. O vôo até White Sands demoraria uma hora e meia.

—Vocês sabem o que está acontecendo? — perguntou Jack. — Porque eu estou no escuro.

—Tenho um breve resumo. Você sabe aquele vazamento que aconteceu na Discoveryontem? Aquele que tentavam identificar? O fato é que os fluidos estavam vazando do saco onde está o cor­po de Kenichi Hirai.

—O saco foi bem fechado. Como vazou?

—Um rasgão no plástico. A tripulação diz que o conteúdo parece estar sob pressão. Está acontecendo algum tipo de decom­posição avançada.

Kittredge descreveu o fluido como verde, com um leve odor de peixe. Isso não me parece a descrição de um fluido oriun­do de um corpo em decomposição.

—Estamos todos intrigados. O saco foi selado outra vez. Teremos de esperar que aterrissem para descobrir o que está acon­tecendo lá dentro. É a primeira vez que lidamos com despojos humanos em microgravidade. Talvez haja algo de diferente quan­to ao processo de decomposição. Talvez as bactérias anaeróbias morram e seja por isso que o cadáver não exale odores fétidos.

—Como está a tripulação?

—Tanto Hewitt quanto Kittredge queixam-se de fortes dores de cabeça. Mercer está vomitando como um cachorro e O'Leary está com dores abdominais. Não estamos certos de quanto disso é psicológico. Tem de haver alguma reação emocional quando você engole pedaços de um colega em decomposição.

Os fatores psicológicos certamente complicavam a situação. Sempre que há um surto de intoxicação alimentar, uma significa­tiva porcentagem das vítimas está, em verdade, livre de infecção. O poder da sugestão é tão forte que pode causar vômitos tão se­veros quanto qualquer doença de verdade.

—Tiveram de atrasar o desacoplamento. White Sands tam­bém estava tendo problemas. Um de seus TACAN estava transmitindo sinais erráticos. Precisaram de algumas horas para fazê- los voltar a funcionar.

O TACAN, ou Sistema Tático de Localização para Navegação Aérea, constituía uma série de transmissores no solo que forne­ciam atualizações de vetor de navegação para o veículo orbital. Um sinal de TACAN defeituoso poderia fazer o ônibus espacial errar completamente a pista.

—Agora, decidiram que não podem esperar — disse Bloomfeld. — Na última hora, a tripulação ficou ainda mais doente. Tanto Kittredge quanto Hewitt estão com hemorragias esclerais. Hirai começou assim.

O avião começou a corrida para a decolagem. O rugido das turbinas preencheu seus ouvidos e o chão se afastou.

Jack gritou acima do barulho das turbinas:

—E quanto à ISS? Há alguém doente na estação?

—Não. Mantiveram as escotilhas fechadas entre os veículos para deter o vazamento.

—Então, está confinado à Discovery?

—Ao que saibamos, sim.

Então Emma está bem, pensou, suspirando profundamente. Emma está a salvo. Mas se o contágio fora levado para bordo da Discoverydentro do cadáver de Hirai, por que a tripulação da es­tação espacial também não foi contaminada?

—Qual o ETA do ônibus espacial? — perguntou Jack.

—Estão desacoplando agora. A queima está programada para daqui a 45 minutos, e a aterrissagem deve ser por volta das 17 horas.

Aquilo não dava muito tempo para o pessoal em terra se preparar. Ele olhou pela janela quando romperam a camada de nu­vens e o sol inundou a cabine. Tudo conspira contra nós, pensou. Uma aterrissagem de emergência. Um TACAN quebrado. Uma tri­pulação doente.

E tudo isso sem contar com uma pista de pouso no meio do nada.

A cabeça de Jill Hewitt doía, e seus globos oculares estavam tão doloridos que ela mal conseguia ver a lista de procedimentos de desacoplamento. Em apenas uma hora, a dor tomara cada mús­culo de seu corpo, e agora ela sentia como se parafusos dentados estivessem rasgando suas costas, suas pernas. O branco de am­bos os olhos ficara vermelho, assim como o de Kittredge. Seus globos oculares pareciam sacos de sangue. Brilhantes. Verme­lhos. Pelo modo como ele se movia e girava a cabeça lentamente, percebeu que ele também sentia dor. Ambos estavam sofrendo, contudo nenhum deles ousou aceitar uma injeção de narcóticos. O desacoplamento e a aterrissagem exigiam atenção total, e não podiam arriscar perder nem uma fração de sua capacidade de concentração.

Leve-nos para casa. Leve-nos para casa. Este era o mantra que se repetia na mente de Jill enquanto ela lutava para conti­nuar na ativa, o suor encharcava sua camisa e a dor atrapalhava sua concentração.

Conferiam a lista de partida. Ela conectou o cabo do computador ThinkPad da IBM em uma das portas de dados do console de popa, ligou-o e abriu o programa de Operações de Encontro e Aproximação.

—Não há fluxo de dados — disse ela.

—O quê?

—A porta de dados deve ter sido danificada pelo vazamento. Vou tentar o PCMMU da coberta.

Ela desconectou o cabo. Cada osso de sua face gritava de dor enquanto ela atravessava o acesso entre os conveses carregando o ThinkPad. Seus olhos pulsavam tanto que pareciam a ponto de saltar das órbitas. Na coberta, viu que Mercer já vestira o traje de lançamento e estava amarrado à poltrona para a reentrada. Esta­va inconsciente, provavelmente por causa da dose de narcóticos. O'Leary, também afivelado à poltrona, ainda estava desperto, mas parecia estar zonzo. Jill foi até a porta de dados da coberta e conectou o ThinkPad.

Ainda sem fluxo de dados.

—Merda. Merda.

Esforçando-se para se concentrar, ela voltou à cabine de comando.

—Sem sorte? — perguntou Kittredge.

—Vou mudar o cabo fonte e tentar esta porta outra vez.

A cabeça dela doía tanto, agora, que seus olhos estavam marejados de lágrimas. Dentes trincados, ela retirou o cabo e substi­tuiu-o por outro. Religou o computador. Através do Windows, abriu a RPOP. O logotipo do programa de Operações de Encontro e Aproximação apareceu na tela.

O suor se acumulava sobre seu lábio superior quando começou a digitar o tempo da missão. Dias, horas, minutos, segundos. Seus dedos não a obedeciam como deviam. Estavam lentos, desa­jeitados. Ela teve de voltar atrás para corrigir os números. Final­mente, selecionou "Ops Prox" e clicou em "OK".

—RPOP iniciado — disse ela, aliviada. — Pronto para processar dados.

Kittredge disse:

Capcom, estamos prontos para separação?

—Espere,Discovery.

A espera era angustiante. Jill olhou para as mãos e viu que seus dedos estavam começando a ter espasmos, que os músculos de seu antebraço se contraíam como se houvesse uma dúzia de vermes retorcendo-se sob a sua pele. Como se algo vivo estivesse cavando túneis em sua carne. Lutou para manter a mão firme, mas seus dedos continuavam a se retorcer em espasmos elétricos. Leve-nos para casa agora. Enquanto eu ainda sou capaz de fazer esse pássaro voar.

—Discovery— disse o Capcom. — Autorizada separação.

— Entendido. Piloto automático digital em Z baixo. Prontos para desacoplamento. Kittredge lançou a Jill um olhar de pro­fundo alívio. — Vamos para casa — murmurou, e agarrou os controles manuais.

O diretor de vôo Randy Carpenter estava em pé como a estátua do Colosso de Rodes, olhos fixos na tela principal, sua mente de engenheiro monitorando friamente diferentes fluxos de informa­ção visual e as conversas no circuito de comunicação.

Como sempre, Carpenter estava pensando diversos passos adiante. A base de acoplagem estava agora despressurizada. Os en­gates que ligavam o veículo orbital à ISS seriam abertos, e molas previamente comprimidas no sistema de acoplagem delicada­mente afastariam ambos os veículos, fazendo com que se separas­sem. Apenas quando estivessem a dois metros um do outro os ja­tos RCS da Discovery seriam ligados para afastar o veículo orbital. Em qualquer ponto desta delicada sequência de eventos, as coisas podiam dar errado, mas para cada defeito possível, Carpenter ti­nha um plano alternativo. Se os engates de acoplagem não se sol­tassem, disparariam cargas explosivas que arrebentariam os para­fusos de contenção. Se isso falhasse, dois membros da tripulação da ISS poderiam fazer uma EVA e manualmente remover os para­fusos. Tinham planos de emergência para planos de emergência, uma saída para cada defeito.

Ao menos, para cada defeito que conseguiam prever. O que Carpenter temia era o defeito no qual ninguém havia pensado. E agora ele se fazia a mesma pergunta — que sempre fazia no início de uma nova fase da missão: O que não conseguimos antecipar?

— ODS desengatado com sucesso — ouviu Kittredge anunciar. — Engates soltos. Estamos livres agora.

O controlador de voo ao lado de Carpenter deu um pequeno soco de triunfo no ar.

Carpenter pensava adiante, na aterrissagem. O tempo em White Sands continuava firme, ventos de proa de 15 nós. O TACAN estaria ativo e operacional quando o ônibus espacial esti­vesse chegando. Naquele momento, as equipes de terra conver­giam para a pista de pouso. Não havia nenhuma nova falha a vista, embora soubesse que algum defeito poderia estar esperan­do por eles na próxima esquina.

Tudo isso passava por sua cabeça, mas seu rosto estava impassível. Ninguém na sala de controle de voo desconfiava que ele estava sentindo o medo, amargo como bílis, em sua garganta.

A bordo da ISS, Emma também observava e esperava. Todas as atividades de pesquisa estavam temporariamente suspensas. Ha­viam se reunido na cúpula do Nodo 1 para ver o desacoplamento do ônibus espacial. Griggs também monitorava a operação em um ThinkPad da IBM, que mostrava o mesmo programa RPOP que o Controle da Missão de Houston acompanhava.

Através das janelas da cúpula, Emma viu a Discoverycomeçar a se afastar e emitiu um suspiro aliviado. O veículo orbital estava em queda livre agora, a caminho de casa.

O médico de bordo O'Leary flutuava em um transe induzido por narcóticos. Ele injetara 50 miligramas de Demerol em seu pró­prio braço, apenas o bastante para aliviar a dor e permitir que verificasse o cinto de segurança de Mercer e preparar a cabine para a reentrada. Mas mesmo aquela pequena dose de narcótico estava confundindo seus processos mentais.

Estava afivelado em sua poltrona na coberta, pronto para sair de órbita. A cabine parecia entrar e sair de foco, como se ele a estivesse enxergando debaixo d'água. As luzes feriam seus olhos, e ele as desligou. Há alguns instantes, achou ter visto Jill Hewitt passar com o ThinkPad. Agora ela já havia ido embora, mas po­dia ouvir sua voz dolorida no fone de ouvido, além da de Kittredge e de Capcom. Eles haviam desacoplado.

Mesmo em seu estado de torpor, sentia-se impotente, envergonhado por estar amarrado àquela poltrona como um inválido enquanto seus colegas de tripulação estavam na cabine de co­mando lutando para levá-los para casa. O orgulho o obrigou a resistir ao confortável esquecimento do sono, e ele emergiu sob o brilho intenso das luzes da coberta. Buscou a trava de seus arne­ses e, quando as correias se afrouxaram, flutuou para fora do as­sento. A coberta começou a rodar ao seu redor, e ele teve de fe­char os olhos para conter o súbito surto de náusea. Resista, pensou. Mente contra matéria. Eu sempre tive um estômago de fer­ro. Mas não conseguia abrir os olhos e confrontar aquele oscilar desorientador do ambiente.

Até ouvir o som. Foi um farfalhar, tão perto que pensou ter sido Mercer movendo-se enquanto dormia. O'Leary voltou-se na direção do som e deu-se conta de que não estava olhando para Mercer. Ele olhava para o saco de dormir de Kenichi Hirai.

Estava inflando. Expandindo-se.

Meus olhos estão me pregando uma peça, pensou.

Ele piscou e voltou a se concentrar. A mortalha ainda estava estufada, o plástico inflado como um balão sobre o abdome do cadáver. Algumas horas atrás eles haviam remendado o rasgão, e agora a pressão lá dentro parecia estar aumentando outra vez.

Movendo-se através de uma névoa onírica, ele flutuou até o catre e pousou a mão sobre o saco inflado.

E a retirou, horrorizado. Naquele breve instante de contato, ele o sentiu inflar, retrair e inflar outra vez.

O cadáver estava pulsando.

Com suor acumulado sobre o lábio superior, Jill Hewitt observava a Discoveryse afastar da ISS através da janela do teto da cabine. Lentamente, o espaço aumentava entre a nave e a estação, e ela olhou para os dados que fluíam na tela de seu computador. Trinta centímetros de separação. Sessenta. Estamos indo para casa. De re­pente, a dor tomou sua cabeça com punhaladas tão insuportáveis que ela sentiu que estava prestes a desmaiar. Jill resistiu, agarrando-se à consciência com a teimosia de um buldogue.

— ODS concluída — disse ela com dentes trincados.

Kittredge respondeu:

—Mudando para RCS OP, baixo Z.

Usando os propulsores, Kittredge se afastaria lentamente da ISS, movendo-se até um quilômetro abaixo da estação, onde suas órbitas diferenciadas automaticamente começariam a afastá-los.

Jill ouviu o ruído dos propulsores e sentiu o veículo orbital estremecer enquanto Kittredge, nos controles de popa, lentamente os afastava da barra-R. Suas mãos estavam trêmulas e seu rosto estava contraído pelo esforço de manter o controle. Ela, e não o computador, estava pilotando o veículo orbital, e qualquer esbarrão na alavanca de controle os lançaria para fora do trajeto.

Um metro e meio de distância. Três. Haviam superado a fase crucial, afastando-se cada vez mais da estação.

Jill começou a relaxar.

Então ouviu um berro na coberta. Um berro de horror e descrença. O'Leary.

Ela se voltou no exato momento em que uma macabra fonte de restos humanos irrompeu na cabine de comando e explodiu em sua direção.

Kittredge, que estava mais perto do acesso entre os dois conveses, recebeu a maior parte do impacto e foi arremessado contra o controlador manual de rotação. Jill tombou para trás, perdeu o fone de ouvido, o corpo atingido por fragmentos fedorentos de intestinos, pele e tufos de cabelo preto ainda grudados ao couro cabeludo. Era o cabelo de Kenichi.Ela ouviu o ruído dos propul­sores sendo acionados e o veículo orbital pareceu girar ao seu redor. A nuvem de partes desintegradas de um corpo humano se espalhou pela cabine de comando como uma fantasmagórica ga­láxia espiral feita de pedaços flutuantes de plástico, órgãos despe­daçados e aquelas estranhas massas esverdeadas. Uma delas, em forma de uva, flutuou e chocou-se contra uma parede próxima.

Quando líquidos colidem e aderem a superfícies planas em microgravidade, estremecem brevemente por causa do impacto e, então, ficam inertes. Mas aquela coisa não parou de se mover.

Incrédula, Jill viu o movimento se intensificar, como uma superfície perturbada por ondulações. Somente então ela viu, bem no meio daquela massa gelatinosa, um núcleo de algo negro, algo que se movia, revolvendo-se como uma larva de mosquito.

Subitamente, ela viu outra imagem, ainda mais assustadora. Ao olhar pela janela no teto da cabine de comando, viu a estação espacial se aproximando rapidamente, tão perto agora que ela quase podia discernir os rebites da armação de painéis solares.

Em meio ao pânico, ela pegou impulso em uma parede e atravessou a macabra nuvem de carne decomposta, os braços estendidos para a frente para alcançar a alavanca de controle do veículo orbital.

—Rota de colisão! — gritou Griggs no rádio espaço-espaço. — Discovery,vocês estão em rota de colisão!

Não houve resposta.

—Discovery!Reverta o curso!

Emma observou horrorizada enquanto o desastre avançava em sua direção.

Através da cúpula da estação espacial, viu o veículo orbital simultaneamente erguer a proa e girar para estibordo. Viu a asa-delta da Discoverycortando o espaço com impulso suficiente para romper o casco de alumínio da estação. E, na iminente coli­são, via a própria morte chegar.

Subitamente, os propulsores RCS no bico do veículo orbital foram acionados. A Discovery começou a baixar a proa, reverten­do o impulso. Simultaneamente, a asa-delta de estibordo se endi­reitou, mas não rápido o bastante para evitar a principal armação de painéis solares da estação.

Emma sentiu o coração parar de bater e ouviu Luther murmurar:

—Meu Deus.

—CRV! — gritou Griggs em pânico. — Todos para o veículo de resgate!

Braços e pernas se debateram em pleno ar, pés voando em todas as direções, enquanto a tripulação lutava para evacuar o nodo. Nicolai e Luther foram os primeiros a atravessar a escotilha do módulo habitacional. Emma havia acabado de se apoiar na escotilha quando ouviu o ranger de metal rasgado, o rugido do alumínio sendo torcido e deformado pela colisão de dois imensos objetos.

A estação espacial estremeceu e, no terremoto que se seguiu, ela teve a desorientadora visão das paredes do nodo girando, do ThinkPad de Griggs rodopiando no ar e do rosto aterrorizado de Diana, banhado de suor.

As luzes piscaram e se apagaram. Na escuridão, uma luz vermelha piscava.

Uma sirene começou a tocar.

 

O diretor de voo do ônibus espacial Randy Carpenter observava a morte na tela principal.

No instante do impacto do veículo orbital, sentiu como se tivesse levado um soco na boca do estômago e chegou a levar a mão ao peito.

Durante alguns segundos, pairou um silêncio absoluto na sala de controle de vôo. Olhares atônitos voltaram-se para a tela principal. Ao centro, havia um mapa-múndi no qual era traça­da a trajetória do ônibus espacial. À direita, o painel de RPOP estava congelado, a Discoverye a ISS representadas por diagra­mas. O veículo orbital pairava acima da ISS como um brinque­do quebrado. Carpenter sentiu os pulmões se expandirem subi­tamente, dando-se conta de que, em meio ao horror, esquecera-se de respirar.

A FCR transformou-se em caos,

Vôo, não recebemos transmissões de voz — ouviu o Capcom dizer.

A Discoverynão está respondendo.

Voo, ainda estamos recebendo dados do TCS...

Voo, não houve queda na pressão da cabine do veículo orbital. Nenhuma indicação de vazamento de oxigênio.

—E quanto à ISS? — rebateu Carpenter. — Temos transmissões vindas de lá?

—A SVO está tentando entrar em contato. A pressão da estação está caindo...

—Quanto?

—Está em 710... 690. Merda, estão descomprimindo rapidamente!

Uma brecha no casco da estação!, pensou Carpenter.

Mas aquilo não era problema dele e, sim, do pessoal da sala de Operações de Veículo Especial, corredor abaixo.

O engenheiro de sistemas de propulsão subitamente entrou no circuito de comunicação.

Voo, tenho ignição de RCS, F2U, F3U, e F1U. Alguém está operando os controles do veículo orbital.

Carpenter ergueu a cabeça, atento. O painel RPOP ainda estava congelado, sem novas imagens. Mas o relatório da propulsão dizia que os foguetes de manobra da Discovery haviam sido dispa­rados. Devia ser mais do que uma descarga casual. A tripulação estava tentando afastar o veículo orbital da ISS. Mas até terem contato de rádio, não podiam confirmar a situação da tripulação do veículo orbital. Não podiam confirmar se estavam vivos.

Era o pior dos mundos, aquilo que mais temia. Uma tripulação morta em um ônibus espacial em órbita. Embora Houston pudesse controlar a maioria das manobras do veículo orbital através de comandos de solo, não podiam trazê-lo de volta sem auxílio da tripulação. Era necessário um ser humano funcional para acionar os interruptores para a queima de saída de órbita OMS. Era preciso a mão humana para lançar as sondas de dados atmosféricos e baixar os trens de pouso para a aterrissagem. Sem alguém nos controles para realizar tais funções, a Discoveryper­maneceria em órbita, um navio fantasma circundando silencio­samente a Terra durante alguns meses até a sua órbita baixar e ela cair em um rastro de fogo. Era isso que passava pela cabeça de Carpenter à medida que se passavam os segundos, enquanto o pânico lentamente ganhava força ao seu redor na FCR. Ele não podia pensar na estação espacial, cuja tripulação podia estar ago­ra agonizando devido à descompressão. Sua atenção tinha de permanecer centrada na Discovery. Em sua tripulação, cuja so­brevivência parecia cada vez menos provável a cada segundo de silêncio.

Então, ouviram a voz. Fraca, entrecortada.

—Controle, aqui é a Discovery. Houston. Houston...

—É Hewitt! — exclamou o Capcom. — Prossiga, Discovery.

—... grande anomalia... não pude evitar a colisão. O dano estrutural no veículo orbital parece ser mínimo...

—Discovery, precisamos de imagens da ISS.

—Não posso estender a antena Ku... o circuito fechado não funciona.

— Sabe a extensão dos danos na estação?

—O impacto arrebentou o painel solar. Acho que fizemos um buraco no casco...

Carpenter sentiu-se nauseado. Ainda não tinham notícia da tripulação da ISS. Nenhuma confirmação de que haviam sobrevi­vido ao impacto.

—Qual a situação de sua tripulação? — perguntou o Capcom.

Kittredge mal responde. Bateu com a cabeça no painel dos controles de proa. E a tripulação na coberta... não sei como estão...

—Como você está, Hewitt?

—Tentando... oh, meu Deus, minha cabeça...

Ouviu-se um soluço de choro. Então ela disse:

—Está vivo.

—Não entendi.

—A coisa que está flutuando na cabine... o vazamento da mortalha. Está se movendo ao meu redor. Está dentro de mim. Posso vê-lo se mover sob a minha pele, e está vivo.

Um calafrio subiu pela coluna de Carpenter.

Alucinações.

Deve ter batido com a cabeça. Eles a estavam perdendo, assim como à chance de trazer de volta o veículo orbital.

Vôo, estamos nos aproximando do momento da queima de saída de órbita — advertiu o FDO. — Não podemos perder a oportunidade.

—Diga-lhe para sair de órbita — ordenou Carpenter.

Discovery— disse o Capcom. — Autorizado o pré-início da APU.

Não houve resposta.

Discovery? — repetiu o Capcom. — Você vai perder o ponto de queima! — À medida que os segundos se passavam, os músculos de Carpenter ficavam mais tensos, e seus nervos pare­ciam fios carregados de eletricidade. Ele suspirou aliviado quan­do Hewitt finalmente respondeu:

—Tripulação da coberta em posição de aterrissagem. Ambos estão inconscientes. Eu os prendi às poltronas. Mas não consigo vestir o LES de Kittredge...

—Dane-se o traje de reentrada! — exclamou Carpenter. — Não percamos o ponto. Apenas traga este pássaro para baixo!

—Discovery, aconselhamos a procederem diretamente ao pré-início de APU. Prenda Kittredge na poltrona de estibordo e proceda com a saída de órbita.

Ouviram um terrível grito de dor. Então Hewitt disse:

—Minha cabeça... estou com dificuldade para me concentrar...

—Entendido, Hewitt. — disse a voz do Capcom, mais gentil, quase consoladora. — Veja, Jill, sabemos que você está no comando agora. Sabemos que está sofrendo. Mas podemos guiá-la em aterrissagem automática, até as rodas pararem de rodar na pista. Apenas fique conosco.

Ela emitiu um soluço torturado.

—Pré-início de APU completado — murmurou. — Carregando OPS 3-0-2. Diga-me quando, Houston.

Iniciar queima para saída de órbita — disse Carpenter.

O Capcom transmitiu a instrução:

Iniciar queima para saída de órbita, Discovery.— E acrescentou em voz baixa. — Agora, deixem-nos trazê-los para casa.

Em meio à escuridão infernal, Emma se preparou para o choque da descompressão. Ela sabia exatamente o que esperar. Como morreria. Ouviria o rugido do ar escapando pelo casco. O súbito estourar de seus tímpanos. O rápido aumento da dor enquanto seus pulmões se expandiam e seus alvéolos explodiam. A medida que a pressão do ar baixa até chegar ao vácuo absoluto, a temperatura em que os líquidos fervem também baixa, até tornar-se a mesma da temperatura de congelamento. Em um instante, o sangue ferve. No outro, congela solidamente em suas veias.

As luzes vermelhas de advertência, a sirene, confirmavam os seus maiores temores. Era uma emergência de Classe 1. Tinham um casco avariado, e seu ar estava escapando para o espaço.

Sentiu os ouvidos estalarem. Evacuar agora!

Ela e Diana entraram no módulo habitacional, atravessando a penumbra iluminada apenas pelo brilho vermelho das luzes dos painéis de advertência. A sirene era tão alta que tinham de gritar para se fazerem ouvir. Em pânico, Emma esbarrou em Luther, que a segurou antes que ela ricocheteasse em outra direção.

—Nicolai já está no CRV. Você e Diana são as próximas! — gritou.

—Espere. Onde está Griggs? — perguntou Diana.

—Apenas entre!

Emma se voltou. Sob o brilho psicodélico das luzes vermelhas de advertência, não viu mais ninguém no módulo habitacional. Griggs não os seguira. Uma névoa estranha e fina parecia pairar na penumbra, mas não era sugada em direção à ruptura.

E ela não sentia dor, deu-se conta. Sentira os ouvidos estalarem, mas não sentia dor no peito, nenhum sintoma de descom­pressão explosiva.

Podemos salvar esta estação. Temos tempo de isolar o vazamento.

Deu uma volta de nadador, chutou a parede e saiu voando em direção ao nodo.

—Ei! Mas que merda, Watson? — gritou Luther.

—Não abandone o navio!

Ela ia tão rápido que bateu na borda da escotilha, machucando o cotovelo. Lá estava a dor agora, não por causa da descompressão, mas por sua falta de jeito. O braço doía quando voltou a tomar impulso para entrar no nodo.

Griggs não estava lá, mas ela viu o ThinkPad dele, flutuando na extremidade do cabo de dados. Na tela piscava um aviso de "Descompressão" em vermelho. A pressão do ar estava em 650 e caindo. Tinham poucos minutos para agir antes que seus cére­bros parassem de funcionar.

Ele deve ter ido procurar o vazamento, pensou Emma. Ele vai fechar o módulo danificado.

Emma entrou no laboratório dos EUA, atravessando a névoa branca que se adensava. Seria névoa ou era a sua visão que estava ficando enevoada por causa da hipoxia? Uma advertência de que estava a ponto de cair inconsciente? Emma atravessou a escuri­dão e se sentiu desorientada pelas luzes de advertência que conti­nuavam a piscar como lâmpadas estroboscópicas. Ela se chocou contra a escotilha. Faltava-lhe coordenação e estava ficando ain­da mais desajeitada. Atravessou a escotilha e entrou no Nodo 2.

Griggs estava lá. Lutava para desligar um emaranhado de cabos estendidos entre o módulo da NASDA e o da ESA.

—O vazamento é no NASDA! — gritou ele acima das sire­nas. — Se tirarmos os cabos dessa escotilha e a fecharmos, poderemos isolar o módulo.

Ela voou até lá para ajudá-lo a desligar os cabos. Então descobriu que um deles não podia ser desconectado.

—O que diabos é isso? — perguntou Emma.

Todos os cabos que atravessavam escotilhas deveriam poder ser facilmente desligados em caso de emergência. Aquele era con­tínuo, uma violação às regras de segurança.

—Não há dispositivo de desconexão! — gritou.

—Consiga uma faca que eu corto!

Ela se voltou e flutuou até o laboratório dos EUA. Uma faca. Onde diabos há uma faca? Em meio aos pulsos de luz vermelha, viu um gabinete de medicina. Um bisturi.Ela abriu uma gaveta, remexeu a bandeja de instrumentos e voltou ao Nodo 2.

Griggs pegou o bisturi e começou a cortar o cabo.

—O que podemos fazer para ajudar?

Emma voltou-se e viu Luther, Nicolai e Diana pairando ansiosamente à escotilha.

—O vazamento é no NASDA! — disse ela. — Vamos fechar o módulo!

Fagulhas irromperam como fogos de artifício. Griggs gritou e afastou-se do cabo.

—Merda! É um cabo carregado!

—Temos de desligá-lo! — exclamou Emma.

—E sermos fritos como torresmos? Negativo.

—Então, como vedar a escotilha?

Luther disse:

Vamos voltar ao laboratório! Fecharemos todo o nodo. Isolaremos esta extremidade da estação.

Griggs olhou para o fio que soltava fagulhas. Ele não queria fechar o Nodo 2, porque significaria sacrificar tanto os módulos da NASDA quanto o da ESA, que estariam completamente despressurizados e inalcançáveis. Também significava abrir mão do ponto de acoplamento do ônibus espacial, que também era anexo ao Nodo 2.

Pressão caindo, pessoal! avisou Diana, lendo um medi­dor de pressão manual. Estamos a 625 milímetros! Apenas voltemos e fechemos a droga do nodo!

Emma já sentia estar respirando mais rápido, tentando recuperar o fôlego. Hipoxia. Todos desmaiariam caso não fizessem algo rapidamente.

Ela agarrou o braço de Griggs.

Recue! É o único meio de salvar a estação!

Ele assentiu, atônito, e recuou com Emma para o laboratório dos EUA.

Luther tentou fechar a escotilha, mas não conseguiu movê-la. Agora que estavam fora do Nodo 2, teriam de puxar, não empur­rar a escotilha para fechá-la. E trabalhavam contra a pressão do ar que escapava em uma rápida despressurização atmosférica.

Teremos de abandonar este módulo também! gritou Luther. Recuar ao Nodo 1 e fechar a próxima escotilha!

Droga, não! disse Griggs. Não vou abrir mão deste módulo também!

Griggs, não temos escolha. Não consigo fechar a escotilha!

Então me deixe fazer isso! Griggs agarrou a alavanca e empurrou com força, mas a escotilha moveu-se apenas alguns centímetros antes dele desistir, exausto.

—Vai matar a todos só para salvar esta merda de módulo! — gritou Luther.

Foi Nicolai quem subitamente gritou a solução,

—Mir! Alimentar o vazamento! Alimentar o vazamento!

Ele saiu do laboratório e dirigiu-se à extremidade russa da estação.

Mir.Todos imediatamente entenderam o que ele estava falando. 1997. A colisão da Progress com o módulo Spektr da Mir. Houvera uma brecha no casco, e a Mircomeçara a liberar no es­paço seu ar precioso. Os russos, com anos de experiência em es­tações espaciais, responderam prontamente à emergência, ali­mentando o vazamento. Introduziram oxigênio extra no módulo para aumentar a pressão. Aquilo não apenas lhes daria tempo para trabalhar, como também estreitaria o gradiente de pressão o bastante para conseguirem fechar a escotilha.

Nicolai voltou voando do laboratório com dois tanques de oxigênio. Freneticamente, abriu as válvulas ao máximo. Mesmo com a sirene ensurdecedora, podiam ouvir o sibilar do ar esca­pando dos tanques. Nicolai atirou ambos os tanques no Nodo 2. Alimentando o vazamento. Estavam aumentando a pressão do ar do outro lado da escotilha.

Também estavam liberando oxigênio em um módulo com um fio energizado, pensou Emma, lembrando-se das fagulhas. Poderiam provocar uma explosão.

—Agora! — gritou Nicolai. — Tentem fechar a escotilha!

Luther e Griggs pegaram a alavanca e puxaram. Jamais saberiam se foi devido ao seu desespero combinado ou se os tanques de oxigênio haviam conseguido baixar o gradiente de pressão através daquela escotilha, mas o fato é que a escotilha lentamente começou a se fechar.

Griggs a travou.

Por um instante, ele e Luther simplesmente pairaram, no lugar onde estavam, ambos exaustos demais para dizer uma pala­vra. Então, Griggs se voltou, o rosto suado iluminado pelas luzes que piscavam.

—Agora vamos desligar esse maldito barulho — disse ele.

No Nodo 1, o ThinkPad ainda flutuava onde fora deixado. Olhando para a tela brilhante, ele rapidamente digitou uma série de comandos. Para o alívio de todos, as sirenes pararam de ber­rar. As luzes vermelhas intermitentes também pararam, ficando apenas o piscar amarelo e constante nos painéis de advertência. Finalmente conseguiam se comunicar sem terem de gritar.

—A pressão do ar está de volta a 690 e subindo — disse ele, sorrindo aliviado depois. — Parece que escapamos.

—Por que ainda estamos em um nível de alerta de Classe 3? — perguntou Emma, apontando para a luz amarela na tela.

Um nível de alerta de Classe 3 podia significar três coisas. O computador de orientação reserva não estava funcionando, um de seus giroscópios de controle de movimento estava inoperante ou haviam perdido a ligação em banda-S com o Controle da Missão.

Griggs digitou mais algumas teclas.

—É a banda-S. Nós a perdemos. A Discoverydeve ter atingido a estrutura P-l e arrancado o rádio. Parece que também atingiu nossas baterias solares de bombordo. Perdemos um módulo fotovoltaico. É por isso que ainda estamos sem energia.

Houston deve estar desesperada tentando entender o que está acontecendo — disse Emma.

—E agora não podem falar conosco. E quanto à Discovery? O que há com eles?

Diana, que já trabalhava no rádio espaço-espaço, disse:

A Discovery não está respondendo. Devem estar fora do alcance do UHF.

Ou estavam todos mortos e não podiam responder.

—Podemos ligar as luzes outra vez? — perguntou Luther. — Cruzar a energia primária?

Griggs voltou a digitar. Parte da beleza do projeto da ISS residia em sua redundância. Cada um de seus canais de energia era configurado para fornecer eletricidade para setores específicos, mas esses canais podiam ser redirecionados — "cruzados" — quando necessário.

Embora tivessem perdido um módulo fotovoltaico, tinham três outros com que contar.

Griggs disse:

—Sei que é um clichê, mas que se faça a luz.

Ele pressionou uma tecla no computador, e as luzes do módulo mal acenderam. Mas era o bastante para poderem navegar através das escotilhas.

—Eu redirecionei a energia. Funções de carga útil não essenciais estão desativadas agora. — Emitiu um profundo suspiro e olhou para Nicolai. — Precisamos entrar em contato com Hous­ton. É hora do show, Nicolai.

O russo compreendeu imediatamente o que devia fazer. O controle da missão de Moscou mantinha um vínculo de comuni­cação separado com a estação. A colisão podia não ter afetado a extremidade russa da ISS.

Nicolai assentiu com gravidade.

—Vamos esperar que Moscou tenha pagado a conta de luz.

 

ITEM 3-7-EXEC

ITEM 3-8-EXEC

OPS 3-0-4 PRO

 

Jill Hewitt arfava de dor, pequenos gemidos que pontuavam cada apertar de botão no painel de controle. Sua cabeça parecia um me­lão maduro pronto para explodir. Seu campo de visão se estreitara de tal forma que ela parecia estar enxergando através de um túnel longo e escuro e que os controles haviam se afastado quase para além de seu alcance. Precisava usar toda a sua concentração para se certificar de qual interruptor devia acionar, para focar a atenção em cada botão instável diante de seu dedo. Agora ela lutava para encontrar o indicador de atitude-direção, com a visão borrada, en­quanto o giroscópio parecia girar violentamente dentro de seu in­vólucro. Não consigo ver. Não consigo discernir arfada de guinada...

—Discovery, você está em interface de entrada — disse o Capcom. — Ponha o flap de fuselagem no automático.

Jill forçou a vista olhando para o painel e estendeu a mão para acionar o interruptor. Mas parecia estar tão longe...

Discovery?

Seus dedos trêmulos tocaram o interruptor. Ela o moveu para a posição "auto".

—Confirmado — murmurou, e deixou os ombros caírem.

Os computadores estavam agora no controle, dirigindo a nave. Ela não confiava em si mesma na alavanca. Ela sequer sabia quanto tempo permaneceria consciente. O túnel negro já se fe­chava sobre a sua visão, engolindo a luz. Pela primeira vez ouviu o som do ar golpeando o exterior do casco e sentiu o seu corpo ser empurrado contra o assento.

O Capcom estava em silêncio. Ela estava em blecaute de comunicação, a espaçonave atravessando a atmosfera com tal força que arrancava os elétrons das moléculas de ar. Essa tempestade eletromagnética interrompia todas as ondas de rádio, cortava toda comunicação. Nos 12 minutos seguintes, seriam apenas ela, a nave e o rugido do ar.

Nunca se sentira tão só.

Percebeu quando o piloto automático começou a primeira manobra de desaceleração, girando a espaçonave de lado, reduzindo-lhe a velocidade. Ela imaginou o brilho nas janelas da cabi­ne e pôde sentir seu calor, como o sol de encontro ao seu rosto.

Ela abriu os olhos e só viu escuridão.

Onde estão as luzes? pensou. Onde está o brilho na janela?

Piscou diversas vezes e esfregou os olhos, como para forçá-los a ver, para forçar suas retinas a absorverem luz. Ela estendeu a mão em direção ao painel de controle. A não ser que acionasse os interruptores certos, a não ser que lançasse as sondas de dados atmosféricos e baixasse o trem de pouso, Houston não poderia pousar aquela nave. Não poderiam trazê-la viva de volta para casa. Seus dedos roçaram uma imensa fileira de mostradores e botões, e Jill emitiu um uivo de desespero.

Ela estava cega.

 

O ar no Campo de Teste de Mísseis de White Sands, situado a 1,2 mil metros acima do nível do mar, estava seco e rarefeito. A pista de pouso atravessava o que outrora fora o leito de um mar e localizava-se em um vale formado entre as cadeias de montanhas de Sacramento e Guadalupe a leste, e as montanhas San Andres, a oeste. A cidade mais próxima era Alamogordo, no Novo México. O terreno era árido e apenas a vege­tação mais resistente do deserto conseguia sobreviver.

A área servira durante muito tempo como base de treinamento para pilotos de caça. Também tivera outros usos ao lon­go das décadas. Durante a Segunda Guerra Mundial, abrigava um campo de prisioneiros alemães. Serviu também como o ponto Trinity, onde os EUA explodiram a sua primeira bomba atômica, montada não muito longe dali, em Los Alamos. Arame farpado e anônimos prédios governamentais haviam brotado naquele vale desértico, mas suas funções eram um mistério até mesmo para os moradores de Alamogordo.

Através de binóculos, Jack podia ver a pista de pouso emanando calor a distância. A pista 16/34 tinha uma orientação qua­se norte-sul, 4,5 quilômetros de extensão e 90 metros de largura — larga o bastante para receber os jatos mais pesados, mesmo naquele ar rarefeito, o que tornava as aterrissagens e decolagens mais longas.

A oeste do ponto de aterrissagem, Jack e a equipe médica esperavam a chegada da Discovery, junto a um pequeno comboio de veículos da NASA e da United Space Alliance. Traziam macas, oxigênio, desfibriladores e kits ACLS — tudo o que se encontra em uma ambulância moderna; e ainda mais. Nas aterrissagens em Kennedy, havia 150 membros da equipe de terra preparados para receber o veículo orbital Ali, naquele pedaço de deserto, mal ha­via uma dúzia, e oito deles eram de pessoal médico. Alguns ves­tiam roupas de proteção atmosférica, para isolá-los de qualquer vazamento de propelente. Seriam os primeiros a encontrar o veí­culo orbital e, com sensores atmosféricos, rapidamente estabele­ceriam o risco de explosões antes de permitirem que os médicos e enfermeiras se aproximassem.

Um rumor distante fez Jack baixar o binóculo e olhar para leste. Helicópteros se aproximavam, tantos que pareciam um en­xame de vespas negras.

—O que é isso? — perguntou Bloomfeld, também perceben­do os helicópteros. Agora, o restante da equipe de terra olhava para o céu, murmurando, intrigada.

—Podem ser reforços — disse Jack.

Ao ouvir a sua unidade de comunicação, o líder do comboio balançou a cabeça,

—O Controle da Missão diz que não são nossos.

—Este espaço aéreo tem de estar livre de aeronaves — disse Bloomfeld.

—Estamos tentando nos comunicar com os helicópteros, mas não estão respondendo.

O rumor aumentava, e Jack podia senti-lo em seus ossos agora, uma batida profunda e constante no esterno. Eles iam invadir o espaço aéreo do veículo orbital. Em 15 minutos, a Discovery cairia do céu e encontraria aqueles helicópteros em seu caminho. Ele ouviu o líder do comboio falando com urgência em seu fone de ouvido e sentiu o pânico que começava a tomar conta da equi­pe de terra.

—Estão firmando posição — disse Bloomfeld.

Jack ergueu o binóculo. Contou cerca de 12 helicópteros. De fato, eles haviam interrompido a aproximação e agora estavam pousando, como um bando de abutres, a leste do ponto de ater­rissagem do veículo orbital.

—O que acha que é isso? — perguntou Bloomfeld.

Ainda faltavam dois minutos de blecaute nas comunicações. Quinze minutos até a aterrissagem.

Randy Carpenter começava a se sentir otimista. Sabia que podiam aterrissar a Discovery em segurança. Afora uma catastrófica pane de computador, poderiam comandar aquele pássaro do solo. Hewitt era a chave de tudo. Ela tinha que permanecer cons­ciente e estar apta para acionar dois interruptores na hora certa. Tarefas simples, embora cruciais. Em seu último contato de rá­dio, dez minutos antes, Hewitt parecia alerta, mas sofria de dores. Ela era uma boa piloto, uma mulher com uma espinha de aço temperado na refinada forja da Marinha dos EUA. Tudo o que ela precisava fazer era se manter consciente.

Voo, temos boas notícias do NASCOM — disse o controle de terra. — O Controle da Missão em Moscou fez contato pelo rádio com a ISS na faixa-S Regul.

Regul era o sistema russo de rádio de faixa-S a bordo da ISS. Era completamente separado e independente do sistema dos

EUA, operado através de estações de terra russas e do seu satélite LUCH.

O contato foi breve. Estavam no fim da passagem do satélite LUCH — disse o controle de terra. — Mas a tripulação está viva e passa bem.

O otimismo de Carpenter aumentou e ele fechou os dedos gorduchos em um punho triunfante.

—Relatório de danos?

—Têm uma brecha no casco do módulo da NASDA e tive­ram de fechar o Nodo 2 e tudo mais dali em diante. Também perderam ao menos dois painéis solares e diversos segmentos de estrutura treliçada. Mas ninguém está ferido.

Vôo, estamos saindo do blecaute de comunicação — disse o Capcom.

Imediatamente, a atenção de Carpenter voltou-se para a Discovery.Estava feliz com as notícias da ISS, mas sua responsabili­dade principal era o ônibus espacial.

—Discovery,está ouvindo? — perguntou o Capcom. — Discovery?

Os minutos passavam. Minutos demais. Logo Carpenter estaria novamente à beira do pânico.

A orientação informou:

Segunda volta em S completada. Todos os sistemas pare­cem operacionais.

Então, por que Hewitt não respondia?

Discovery— repetiu o Capcom, agora com urgência na voz. — Está ouvindo?

—Entrando na terceira volta em S — disse a orientação.

Nós a perdemos, pensou Carpenter.

Então, ouviu a voz de Jill. Baixa e trêmula.

—Aqui é a Discovery.

Ouviram claramente o suspiro de alívio do Capcom no circuito de comunicação.

—Discovery,bem-vinda de volta! É bom ouvir sua voz! Ago­ra precisa lançar as sondas de informações atmosféricas.

—Eu... estou tentando encontrar os interruptores.

— Suas sondas de informações atmosféricas — repetiu o Capcom.

—Eu sei, eu sei! Não consigo ver o painel!

Carpenter sentiu o sangue gelar em suas veias. Meu Deus, ela está cega. E está sentada na poltrona do comandante, não na sua.

—Discovery, precisa lançar as sondas agora! — repetiu o Capcom. — Painel C-três...

—Eu sei qual o painel! — gritou.

Houve um silêncio. Então, o som de sua respiração em um suspiro de dor.

—As sondas foram lançadas — disse o MMACS. — Ela conseguiu. Ela encontrou o interruptor!

Carpenter permitiu-se voltar a respirar. Voltar a ter esperança.

—Quarta volta em S — disse a orientação. — Agora, em interface TAEM.

—Discovery, como está indo? — perguntou o Capcom.

Um minuto e trinta segundos para a aterrissagem. A Discovery viajava agora a quase mil quilômetros por hora, a uma altitude de 8 mil pés e caindo rapidamente. Os pilotos a chamavam de "tijolo voador" — pesado, sem motores, planando sobre asas-delta. Não havia segundas chances, nada de cancelar o pouso e dar uma volta para tentar outra vez. Ela aterrissaria de um modo ou de outro.

—Discovery?— chamou o Capcom.

Jack podia vê-la brilhando no céu, rastros de fumaça emanando de seus jatos de guinada. Parecia uma lasca de prata brilhante enquanto fazia a volta final para se alinhar com a pista.

—Vamos lá, garota. Você parece bem! — gritou Bloomfeld.

Seu entusiasmo foi compartilhado pelos 36 membros da equipe de terra.

Toda aterrissagem de ônibus espacial é um evento de celebração, uma vitória tão comovente que faz as lágrimas brota­rem dos olhos daqueles que a assistem do solo. Todos os olhos estavam agora voltados para o céu, cada coração batendo forte enquanto observavam aquela lasca de prata, seu bebê, planando em direção à pista.

—Que beleza. Meu Deus, ela é linda!

—Viva!

—O alinhamento está perfeito! Sim senhor!

Ouvindo Houston em seu fone de ouvido, o líder do com­boio ficou tenso, coluna ereta, e disse inesperadamente:

Oh, merda. Os trens de pouso não foram baixados!

Jack voltou-se para ele.

— O quê?

—A tripulação não baixou o trem de pouso!

Jack voltou-se para observar o ônibus espacial que se aproximava. Estava a menos de 30 metros do chão, movendo-se a mais de 480 quilômetros por hora. Ele não via as rodas.

A multidão subitamente se calou. A celebração se transformou em descrença. Em horror.

Jack teve vontade de gritar: Abaixe. Abaixe essas rodas!

O ônibus espacial estava a 23 metros acima da pista, perfeitamente alinhado. Dez segundos até a aterrissagem.

Apenas a tripulação podia baixar o trem de pouso. Ne­nhum computador podia acionar o interruptor, tarefa conce­bida para ser feita por mãos humanas. Nenhum computador poderia salvá-los.

Quinze metros e ainda voando a mais de 300 quilômetros por hora.

Jack não queria ver o evento final, mas não conseguiu des­viar o olhar. Ele viu a cauda da Discoverybater no chão, lançan­do uma chuva de fagulhas e ladrilhos térmicos estilhaçados. Ouviu os gritos e lamentos da multidão quando a proa da Discovery bateu a seguir. O ônibus espacial começou a escorregar de lado, espalhando um redemoinho de detritos. Uma asa-delta se quebrou e saiu rodopiando como uma foice negra. O ônibus espacial continuou a se arrastar de lado, produzindo um ruído ensurdecedor.

A outra asa se quebrou, rodou, estilhaçou-se. A Discovery saiu da pista e ganhou a areia do deserto. Um tornado de poeira se ergueu, obscurecendo a visão de Jack dos segundos finais. Seus ouvidos estavam tomados pelos gritos da multidão, mas ele não conseguia emitir qualquer som. Também não podia se mover. O choque o adormecera tão profundamente que sentiu como se ti­vesse deixado o próprio corpo e estivesse pairando, como um fantasma, em algum pesadelo.

Então, a nuvem de poeira começou a baixar e ele viu o ônibus espacial, tombado como um pássaro ferido em uma terrível pai­sagem de destroços.

Subitamente, os motores foram ligados e o comboio come­çou a se mover. Jack e Bloomfeld pularam de volta no interior do veículo médico para atravessar o terreno pedregoso do deserto em direção ao local do desastre. Mesmo em meio ao rugido dos motores do comboio, Jack ouvia outro som, palpitante e ameaçador.

Os helicópteros também estavam se aproximando.

O veículo parou abruptamente. Carregando kits médicos de emergência, Jack e Bloomfeld pularam no chão em uma nuvem de poeira. A Discovery ainda estava a uns 90 metros de distância. Os helicópteros já haviam pousado, formando um círculo em torno do ônibus espacial, barrando o acesso do comboio.

Jack começou a correr em direção à Discovery,pronto para baixar a cabeça sob as pás das hélices dos rotores. Foi parado an­tes de chegar aos helicópteros.

—O que diabos está acontecendo? — gritou Bloomfeld, quando soldados uniformizados saltaram dos helicópteros e for­maram uma parede armada diante do pessoal de terra da NASA.

—Afastem-se! Afastem-se! — gritou um dos soldados.

O líder do comboio tomou a frente.

—Minha equipe precisa chegar ao veículo orbital!

— Seu pessoal vai ficar onde está!

—Vocês não têm autoridade aqui! Isto é uma operação da NASA!

—Todo mundo para trás agora, porra!

Os soldados ergueram os rifles, canos apontados para a equi­pe de terra desarmada. O pessoal da NASA começou a se afastar, olhos fixos nas armas, na ameaça implícita de uma chacina.

Olhando para além dos soldados, Jack viu que erguiam rapidamente uma tenda de plástico branco sobre a escotilha da Dis­covery, isolando-a do ar exterior. Doze figuras encapuzadas ves­tindo roupas cor de laranja emergiram de dois helicópteros e se aproximaram do veículo orbital.

—Estão usando trajes espaciais biológicos Racal[2] — disse Bloomfeld.

A escotilha do veículo orbital estava agora completamente oculta sob uma tenda de plástico. Eles não puderam ver a escoti­lha ser aberta, assim como não viram aqueles sujeitos com trajes espaciais entrarem na coberta.

É a nossa tripulação que ali está, pensou Jack. É a nossa gente que pode estar morrendo naquele veículo orbital. E não podemos nos aproximar. Temos médicos e enfermeiras aqui, um caminhão repleto de equipamento médico, e eles não nos deixam fazer o nosso trabalho.

Ele foi até a fileira de soldados e parou diante do oficial que parecia estar no comando.

—Minha equipe médica vai entrar — disse ele.

O oficial sorriu com desdém.

—Creio que não, senhor.

— Somos funcionários da NASA. Somos médicos, encarregados da saúde e do bem-estar daquela tripulação. Pode atirar em nós se quiser. Mas terão de matar todo mundo aqui, porque to­dos serão testemunhas. E não acredito que você faça isso.

O rifle se ergueu, o cano apontado diretamente para o peito de Jack. Sua garganta estava seca e seu coração batia contra as costelas, mas ele contornou o soldado, passou sob as pás da hélice e continuou andando.

Nem mesmo olhou para trás quando o soldado ordenou:

—Pare ou eu atiro!

Ele continuou andando, olhar fixo na tenda à sua frente. Viu os homens em trajes Racal se voltarem e olharem surpresos para ele. Viu o vento erguer um punhado de areia e fazê-lo redemoi­nhar diante de seu caminho. Estava quase na tenda quando ouviu Bloomfeld gritar:

—Jack, cuidado!

O impacto o atingiu na base do crânio. Ele caiu de joelhos, vendo estrelas de dor. Outro o atingiu no lado do tórax, e ele caiu de cara na areia quente do deserto. Jack rolou de costas e viu o soldado vindo em sua direção, cabo do rifle erguido para golpear outra vez.

—Já basta — disse uma voz estranhamente abafada. — Deixe-o em paz.

O soldado se afastou. Agora outra face surgia em cena, olhando para Jack através da viseira transparente do traje Racal.

—Quem é você? — perguntou o sujeito.

—Dr. Jack McCallum.

Suas palavras não eram mais altas que um murmúrio. Ele se sentou e sua visão ficou borrada, oscilando no limiar da escuri­dão. Ele levou as mãos à cabeça, desejando ficar consciente, lu­tando contra a escuridão que parecia querer dominá-lo.

—Meus pacientes estão naquele veículo orbital — disse Jack. — Exijo vê-los.

Isso não é possível.

Precisam de cuidados médicos...

—Eles estão mortos, Dr. McCallum. Todos eles.

Jack ficou paralisado. Lentamente, ergueu a cabeça e viu os olhos do homem através da viseira. Não conseguiu decifrar-lhes a expressão e nada viu que refletisse a tragédia da perda de quatro vidas.

Lamento por seus astronautas — disse o homem, e se afastou.

Jack lutou para se erguer. Embora tonto e cambaleante, conseguiu ficar de pé.

—E quem diabos é você? — perguntou.

O homem fez uma pausa e se voltou.

—Sou o Dr. Isaac Roman, do USAMRIID — disse ele. — Aquele veículo orbital é agora uma área de risco. O exército vai assumir o controle.

USAMRIID. O Dr. Roman pronunciara aquilo como uma só pa­lavra, mas Jack sabia o que as letras queriam dizer: Instituto de Pesquisas Médicas de Doenças Infecciosas do Exército dos EUA. Por que o exército estava lá? Desde quando aquilo se tornara uma operação militar?

Jack protegeu os olhos da areia levada pelo vento, a cabeça ainda dolorida por causa da pancada, e lutou para registrar aquela informação terrível. Uma eternidade pareceu ter se passado, uma progressão de imagens surrealistas em câmera lenta. Homens em trajes Racal caminhando em direção ao veículo orbital. Os soldados olhando para ele com olhos inexpressivos. A tenda de isolamento agitada pelo vento, como um organismo vivo a respi­rar. Olhou para os soldados que ainda mantinham a equipe de terra a distância. Olhou para o veículo orbital e viu os homens em trajes espaciais tirarem a primeira maca da tenda. O corpo estava selado dentro de um saco. O plástico fora carimbado repetidas vezes com o símbolo vermelho-vivo de risco patogênico, como flores jogadas sobre um cadáver.

A visão daquela maca fez a mente de Jack voltar à razão.

— Para onde estão levando os corpos? — perguntou.

O Dr. Roman sequer virou-se para ele. Em vez disso, mandou que a maca fosse levada até um dos helicópteros. Jack voltou a ca­minhar em direção ao veículo orbital, mas outra vez encontrou um soldado à sua frente, o cabo do rifle pronto para golpear outra-vez.

—Ei! — gritou alguém da equipe de terra. — Se ousar atingi- lo de novo, temos trinta testemunhas aqui!

O soldado voltou-se e olhou para os furiosos funcionários da NASA e da United Space Alliance, que agora avançavam, vozes ultrajadas.

—Acham que isso aqui é a Alemanha nazista?

—... acham que podem espancar civis agora?

—Quem diabos são vocês?

Nervosos, os soldados cerraram fileiras enquanto a tripulação de terra continuava a avançar, gritando, os pés levantando poeira.

Um rifle foi disparado para o ar. A multidão silenciou.

Há algo de muito errado acontecendo por aqui, pensou Jack. Algo que não entendemos. Esses soldados estão prontos para atirar para matar.

O líder do comboio também entendeu aquilo porque gritou, em pânico:

—Estou em contato com Houston! Neste momento, uma centena de pessoas no Controle da Missão está nos ouvindo!

Lentamente, os soldados baixaram os rifles e olharam para seu oficial. Seguiu-se um longo silêncio, quebrado apenas pelo vento e pelas rajadas de areia que golpeavam os helicópteros.

O Dr. Roman apareceu ao lado de Jack.

—Sua gente não compreende a situação — disse ele.

—Explique-nos.

—Estamos lidando com um sério risco patogênico. O Conselho de Segurança da Casa Branca ativou a Equipe de Resposta Biológica Rápida do Exército, criada por um ato do Congresso, Dr. McCallum. Estamos aqui por ordens da Casa Branca.

—Qual risco patogênico?

Roman hesitou. Ele olhou para a equipe de terra da NASA, aglomerada além da linha de soldados.

—Qual o organismo? — perguntou Jack.

Finalmente, Roman olhou para ele através da viseira de plástico.

—Esta informação é confidencial.

—Somos a equipe médica encarregada da saúde desta tripulação. Por que não fomos informados?

—A NASA não sabe com o que está lidando.

—E como vocês sabem?

A pergunta, repleta de significado, ficou sem resposta.

Outro corpo emergiu da tenda. De quem seria?, perguntou-se Jack. Os rostos dos quatro membros da tripulação passaram por sua mente.

Todos mortos agora. Ele não conseguia aceitar aquilo. Não conseguia imaginar aquela gente vibrante e saudável reduzida a ossos quebrados e órgãos rompidos.

Para onde estão levando os corpos? — perguntou.

Para uma instalação de Nível 4, para necropsia.

—Quem fará a necropsia?

Eu farei.

—Como cirurgião de vôo da tripulação, devo estar presente.

Por quê? Você é patologista?

Não.

—Então não vejo como possa ser útil.

Quantos pilotos mortos já examinou? — rebateu Jack. — Quantos acidentes aéreos já investigou? Eu fui treinado para trauma aeroespacial. É o meu campo de especialização. Podem precisar de mim.

—Não creio — disse Roman antes de se afastar.

Rígido de ódio, Jack olhou para a tripulação de terra da NASA e disse para Bloomfeld:

—O exército assumiu o controle deste lugar. Estão levando os corpos.

—Com que autoridade?

Dizem que a ordem veio diretamente da Casa Branca. Ativaram algo chamado Equipe de Resposta Biológica Rápida.

—E uma equipe antiterrorista — disse Bloomfeld. — Ouvi falar deles. Foram criados para lidar com bioterrorismo.

Observaram o helicóptero decolar levando os dois corpos.

Que diabos está acontecendo? O que estão escondendo de nós?

Ele se voltou para o líder do comboio.

—Pode me conectar com o JSC?

—Alguém em particular?

Jack pensou em quem podia confiar, em quem era forte o bastante dentro da burocracia da NASA para elevar a batalha ao nível mais alto possível.

Gordon Obie — disse ele. — Operações de Tripulações de Vôo.

 

A Necropsia

Gordon Obie entrou na sala de conferência de vídeo preparado para uma batalha sangrenta, mas ne­nhuma das autoridades sentadas ao redor da mesa suspeitava o quanto ele estava furioso. Não era de se estranhar. Obie exibia sua habitual expressão de jogo de pôquer e não disse uma palavra ao se sentar à mesa, ao lado da uma diretora de relações públicas, Gre­tchen Liu, chorosa e de olhos inchados. Todos pareciam absoluta­mente chocados. Sequer notaram a entrada de Gordon.

Também à mesa estavam o administrador da NASA, Leroy Cornell, o diretor do JSC, Ken Blankenship, e meia dúzia de altas autoridades da NASA, todos olhando para duas telas de vídeo com expressões sombrias. Na primeira, estava o coronel Lawrence Harrison, do USAMRIID, falando da base do exército em Fort Detrick, em Maryland. No segundo monitor, um homem solene de cabelos escuros e vestindo roupas civis identificado como Jared Profitt, Conselho de Segurança da Casa Branca. Não parecia um burocrata. Com olhos repletos de pesar e um rosto magro, quase ascético, parecia mais um monge medieval, transportado a contragosto a uma Idade Moderna de ternos e gravatas.

Blankenship dirigia os seus comentários ao coronel Harrison:

—Seus soldados não apenas impediram que meu pessoal fizesse o seu trabalho, como o ameaçou à ponta de armas. Um de nossos cirurgiões de voo foi atacado... derrubado pelo cabo de um rifle. Temos 36 testemunhas...

—O Dr. McCallum invadiu o nosso cordão de segurança. Recusou-se a parar como foi ordenado — respondeu o coronel Harrison. — Tínhamos uma zona de risco a proteger.

—Então o exército dos EUA está preparado para atacar e até disparar contra civis?

Ken, vamos tentar ver isso do ponto de vista do USAMRIID — disse Cornell, pousando a mão sobre o braço de Blankenship.

O toque diplomático, pensou Gordon, incomodado. Cornell podia ser o porta-voz da NASA na Casa Branca e sua melhor op­ção no que dizia respeito a adular o Congresso para conseguir dinheiro, mas muita gente na NASA nunca confiara nele de fato. Nunca poderiam confiar em alguém que pensava mais como po­lítico do que como engenheiro.

—Proteger uma área de risco é um motivo válido para a aplicação de força — disse Cornell. — O Dr. McCallum rompeu a linha de segurança.

—E os resultados poderiam ter sido desastrosos — disse Harrison pela linha de áudio. — Nossos relatórios da inteligência afir­mam que o vírus Marburg pode ter sido introduzido propositalmente na estação espacial. Marburg é um primo do vírus Ebola.

—Como entraria a bordo? — perguntou Blankenship. — Todo protocolo de experiência é revisado pela segurança. Todo animal de laboratório é saudável. Não mandamos patógenos para o espaço.

—Claro que esta é a linha de sua agência. Mas vocês recebem cargas úteis experimentais de cientistas de todo o país. Vocês po­dem vasculhar seus protocolos, mas não podem examinar cada bactéria ou cultura de tecidos que chega para o lançamento. Para manter o material biológico vivo, as cargas úteis são embarcadas diretamente no ônibus espacial. E se uma dessas experiências es­tiver contaminada? Considere quão fácil seria substituir culturas inofensivas por organismos perigosos como o Marburg.

—Está dizendo que isso foi uma tentativa de sabotagem deliberada contra a estação? — perguntou Blankenship. — Um ato de bioterrorismo?

—É exatamente isso que estou dizendo. Deixe-me descrever o que acontece se você for infectado por esse vírus em particular. Primeiro seus músculos começam a doer e você fica com febre. A dor é tão severa, agonizante, que você mal pode ser tocado. Uma injeção intramuscular o faz berrar de dor. Então, seus olhos ficam vermelhos. Sua barriga começa a doer e você vomita sem parar. Começa a vomitar sangue. Vem negro, a princípio, por causa dos processos digestivos. Então fica vermelho-vivo, tão rápido quanto uma bomba de sucção. Seu fígado incha, racha. Seus rins param de funcionar. Os órgãos internos são destruídos, transformando-se em um purê fedorento e escuro. Então, desastrosamente, a sua pressão arterial cai e você morre. — Harrison fez uma pausa. — E com isso que podemos estar lidando, cavalheiros.

—Isso é babaquice! — gritou Gordon Obie.

Todos à mesa o olharam para ele, atônitos. A Esfinge falara. Nas raras ocasiões em que Obie dissera algo em uma reunião, geralmente era em um tom de voz monocórdio, e suas palavras costumavam expor dados e informações, não emoção. Aquele rompante chocou a todos.

—Posso perguntar quem acabou de falar? — perguntou o coronel Harrison.

Sou Gordon Obie, Diretor de Operações de Tripulações de Vôo.

Ah, o chefão dos astronautas.

Por assim dizer.

E por que isso é uma babaquice?

Não creio ser um vírus Marburg. Não sei o que é isso, mas sei que não está nos dizendo a verdade.

O rosto do coronel Harrison congelou em uma máscara rígida. Ele não falou. Foi Jared Profitt quem tomou a palavra. Sua voz soava exatamente como Gordon esperava: fina e modulada. Ele não era agressivo como Harrison, mas um homem que prefe­ria apelar para o intelecto e a razão.

Compreendo a sua frustração, Sr. Obie disse Profitt. Há muita coisa que não podemos revelar por questões de seguran­ça. Mas o Marburg é algo com o qual não podemos brincar.

Se já sabem que é mesmo o Marburg, então por que estão excluindo os nossos cirurgiões de voo da necropsia? Têm medo de que descubramos a verdade?

Gordon, por que não discutimos isso em particular? murmurou Cornell.

Gordon ignorou-o e disse para a tela:

De que doença estamos falando aqui? Uma infecção? Uma toxina? Algo carregado no ônibus espacial como carga útil mili­tar, talvez?

Houve um silêncio. Então Harrison explodiu:

De novo essa paranóia da NASA! A sua agência gosta de culpar os militares por tudo que dá errado!

Por que se recusa a admitir meu cirurgião de vôo na necropsia?

Está falando do Dr. McCallum? perguntou Profitt.

Sim. McCallum é especialista em traumas de acidentes aéreos e patologia. Também é um cirurgião de vôo e ex-membro do corpo de astronautas. O fato de se recusarem a deixá-lo a assistir às autópsias, assim como qualquer um de nossos médicos, me faz pensar no que não querem que a NASA veja o que estão fazendo.

O coronel Harrison voltou o rosto para o lado, como se estivesse se dirigindo para outra pessoa na sala. Quando olhou outra vez para a câmera, seu rosto estava vermelho de raiva.

—Isso é absurdo. Vocês derrubaram um ônibus espacial! Vocês estragaram a aterrissagem, mataram a sua própria tripula­ção e agora apontam o dedo acusando o exército dos EUA?

—Todo o corpo de astronautas está unido quanto a isso — disse Gordon. — Queremos saber o que realmente aconteceu com nossos colegas. Insistimos que permitam que um de nossos médicos veja os corpos.

Leroy Cornell voltou a tentar interceder.

Gordon, você não pode fazer exigências assim — murmurou. — Eles sabem o que estão fazendo.

—Eu também.

—Vou pedir que volte atrás agora.

Gordon olhou para Cornell nos olhos. Cornell era o representante da NASA na Casa Branca, a voz da NASA no Congresso. Opor-se a ele era um suicídio profissional. Mas ele o fez mesmo assim.

—Falo pelos astronautas — disse ele. — O meu pessoal, — Ele se voltou para a tela de vídeo, o olhar fixo no rosto pétreo do coronel Harrison. — E não descartamos a possibilidade de levar as nossas preocupações à imprensa. Não é fácil considerar tal hi­pótese, a de expor assuntos confidenciais da NASA. O corpo de astronauta sempre foi discreto. Mas se formos obrigados a tanto, exigiremos uma investigação pública.

Gretchen Liu ficou boquiaberta.

Gordon — sussurrou ela. — O que diabos está fazendo?

—O que tenho de fazer.

O silêncio na mesa se estendeu por um minuto.

Então, para a surpresa de todos, Ken Blankenship disse:

—Estou do lado de nossos astronautas.

—Eu também — disse outra voz.

—Eu também...

—... e eu.

Gordon olhou para seus colegas ao redor da mesa. A maioria daquelas pessoas era de engenheiros e gerentes operacionais cujos nomes raramente apareciam na imprensa. Frequentemen­te, viviam em conflito com os astronautas, a quem consideravam playboys voadores com egos enormes. Os astronautas ficavam com todas as glórias, mas aqueles homens e mulheres que reali­zavam os trabalhos sem glamour que tornavam os voos espaciais uma realidade eram o coração e a alma da NASA. E agora esta­vam do lado de Gordon.

Leroy Cornell pareceu aflito, um líder abandonado por suas tropas. Ele era um homem orgulhoso e encarou aquilo como uma humilhação pública. Cornell pigarreou e lentamente ajeitou os ombros. Então, olhou para a imagem do coronel Harrison no vídeo.

—Não tenho escolha senão também apoiar os astronautas — disse ele. — Insisto que um de nossos cirurgiões de vôo seja admitido para assistir às necropsias.

O coronel Harrison não disse nada. Jared Profitt, que obviamente era quem estava no comando, foi quem tomou a decisão final. Ele se voltou para falar com alguém fora da tela. Então, olhou para a câmera e assentiu.

Ambas as telas se apagaram. A teleconferência havia terminado.

—Bem, você realmente desacatou o exército dos EUA — disse Gretchen. — Viu como Harrison ficou furioso?

Não, pensou Gordon, lembrando-se da expressão do coronel Harrison pouco antes da tela se apagar. Aquilo que vi no rosto dele não era raiva. Era medo.

Os corpos não haviam sido levados para o quartel-general do USAMRIID em Fort Detrick, Maryland, como pensara Jack. Haviam sido transportados para um lugar a cerca de 100 quilômetros da pista de pouso de White Sands, um edifício de concreto sem jane­las, parecido com outras dezenas de prédios governamentais que haviam brotado naquele vale seco e desértico. Mas aquele tinha um detalhe diferente: diversos tubos de ventilação despontavam do teto e havia arame farpado em cima da cerca. Ao atravessarem a barreira militar, Jack ouviu o zumbido de fios de alta voltagem.

Ladeado por sua escolta armada, Jack se aproximou da entrada da frente — a única entrada, deu-se conta. Na porta havia um sím­bolo assustadoramente familiar, a flor vermelha que indicava risco patológico. O que aquela instalação fazia no meio do nada?, pergun­tou-se. Então, ele olhou para o horizonte desolado, e sua pergunta foi respondida. O prédio estava ali precisamente porque ficava no meio do nada.

Jack foi escoltado porta adentro e atravessou uma série de corredores austeros que levavam ao interior do prédio. Viu ho­mens e mulheres com uniformes do exército, outros com roupas de laboratório. Toda luz era artificial, e os rostos pareciam azula­dos e doentios.

Os guardas pararam do lado de fora de uma porta com a pla­ca "Vestiário Masculino".

—Entre — disseram-lhe. — Siga ao pé da letra as instruções escritas. Depois, atravesse a porta. Estão esperando por você.

Jack entrou na sala. Lá dentro havia armários, um carrinho de lavanderia contendo diversos tamanhos de aventais cirúrgicos ver­des, uma prateleira com gorros de papel, uma pia, um espelho. Havia uma lista de instruções na parede que começava com: "Re­mova TODAS as suas roupas de passeio, inclusive as peças íntimas."

Ele se despiu, deixou as roupas em um armário que não esta­va trancado e vestiu o avental. Atravessou a porta seguinte, estampada com o símbolo universal de risco patológico, até uma sala iluminada com luz ultravioleta. Ali, fez uma pausa, perguntando-se o que fazer a seguir.

Uma voz disse ao interfone:

—Há uma prateleira com meias ao seu lado. Calce um par e atravesse a porta.

Foi o que ele fez.

Uma mulher usando um avental cirúrgico o esperava na ou­tra sala. Era rude, séria e disse-lhe para calçar luvas esterilizadas. Então, com gestos bruscos, vedou as mangas de sua camisa e de suas calças com fita adesiva. O exército podia ter se resignado a deixar Jack fazer uma visita. Mas não seria uma visita amistosa. Ela adaptou um fone de ouvido em sua cabeça, então lhe deu um chapéu "Snoopy", parecido com um gorro de natação, para que o equipamento ficasse preso no lugar.

—Agora, vista-se — ordenou.

Hora do traje espacial. Aquele era azul, com luvas já acopladas. Enquanto a hostil assistente baixava o gorro sobre sua cabe­ça, Jack ficou preocupado. Em sua raiva, aquela mulher podia sabotar o processo, fazendo com que ele não ficasse completa­mente isolado e livre de contaminação.

Ela fechou a trava em seu peito, conectou-o a um bico de ar na parede, e ele sentiu o traje inflar. Era tarde demais para se preo­cupar com o que poderia dar errado. Jack estava pronto para en­trar na área de risco.

A mulher desconectou-o do bico de ar e apontou para a por­ta seguinte. Ele a atravessou e ingressou em uma câmara de ar. A porta bateu atrás dele. Um homem vestindo um traje espacial o esperava. Não falou, mas gesticulou para que Jack o seguisse atra­vés de uma porta no outro extremo da câmara.

Eles a atravessaram e desceram um corredor até a sala de necropsia.

Lá dentro havia uma mesa de aço inoxidável sobre a qual havia um corpo deitado, ainda selado dentro do saco. Dois homens em trajes espaciais já estavam ao lado do corpo. Um dos homens era o Dr. Roman. Ele se virou e viu Jack.

— Não toque em nada. Não interfira. Você só está aqui para observar, Dr. McCallum; portanto, fique fora de nosso caminho.

Que boas-vindas!

O sujeito com traje espacial que o escoltava adaptou o traje de Jack a um bico na parede, e mais uma vez o ar sibilou dentro de seu capacete. Não fosse o fone de ouvido, não conseguiria ouvir coisa alguma do que os outros diziam.

O Dr. Roman e seus dois colegas abriram o saco.

Jack sentiu o ar lhe faltar, a garganta se estreitar. Era o corpo de Jill Hewitt. O capacete fora removido, mas ela ainda vestia o traje cor de laranja de lançamento e entrada em órbita, com seu nome bordado. Mesmo sem aquela identificação, saberia que era Jill, por causa do cabelo. Era de um castanho sedoso, curto, os primeiros fios grisalhos começando a despontar. Seu rosto estava estranhamente intacto, os olhos entreabertos. O branco de am­bos os olhos estava vermelho-vivo.

Roman e seus colegas abriram o LES e expuseram o corpo. O tecido era à prova de fogo, grosso demais para ser cortado. Tive­ram de despi-lo. Trabalharam com eficiência, comentários prag­máticos, sem qualquer sinal de emoção. Nua, Jill parecia uma boneca quebrada. Suas duas mãos estavam deformadas por fra­turas, reduzidas a massas de ossos partidos. Suas pernas também estavam quebradas e tortas, as tíbias curvadas em ângulos impos­síveis. As pontas de duas costelas quebradas atravessaram a pare­de torácica, e hematomas escuros marcavam os lugares onde es­tavam os arneses que a prendiam à poltrona.

Jack sentiu estar respirando muito rapidamente e teve de controlar o espanto cada vez maior. Ele testemunhara autópsias em corpos em muito pior estado. Vira pilotos queimados a ponto de parecerem troncos carbonizados, crânios explodidos pela pressão provocada pelo cozimento de seus cérebros. Vira um corpo cujo rosto fora amputado pelas pás do rotor traseiro de um helicóptero. Vira a espinha de um piloto naval quebrada pela me­tade e dobrada para trás por ele ter se ejetado da cabine com a cobertura fechada.

Mas aquilo era muito, muito pior, porque ele conhecia a falecida. Ele se lembrava dela enquanto viva. Seu horror vinha mis­turado com ódio porque aqueles três homens olhavam para o corpo exposto de Jill com frio distanciamento. Para eles, ela era um pedaço de carne sobre a mesa, nada mais. Ignoraram os seus ferimentos, os membros grotescamente fraturados. A causa da morte era uma preocupação secundária para eles. Estavam mais interessados no invasor microbiológico que se escondia em seu cadáver.

Roman começou a incisão em Y. Segurava o bisturi com uma das mãos, a outra protegida por uma luva metálica. Um corte seguia uma diagonal que começava no ombro direito e passava pelo seio até chegar ao processo xifoide. Outro corte diagonal corria do ombro esquerdo e encontrava-se com o primeiro corte no xifoide. A incisão continuava reta até o abdome, com um pe­queno desvio ao redor do umbigo, terminando perto do osso pubiano. Ele cortou as costelas, liberando o esterno. O escudo cor­poral foi erguido para revelar a cavidade torácica.

A causa da morte ficou imediatamente evidente.

Quando um avião cai, um automóvel bate em um muro ou um amante desprezado se joga de um prédio de dez andares, aplicam-se as mesmas forças de desaceleração. O corpo humano, deslocando-se em alta velocidade, para abruptamente. O impacto pode fragmentar as costelas e lançar lascas de ossos como se fos­sem mísseis contra os órgãos vitais. Pode fraturar vértebras, rom­per colunas vertebrais e esmagar crânios contra painéis de instru­mentos. Mas mesmo quando os pilotos estão firmemente presos às suas poltronas e usando capacete, mesmo quando nenhuma parte de seus corpos entra em contato com a aeronave, apenas a força da desaceleração pode ser fatal, porque, embora o torso seja contido, o mesmo não acontece com os órgãos internos. O cora­ção, os pulmões e os grandes vasos sanguíneos estão suspensos dentro do tórax, seguros apenas por tecidos conjuntivos. Quan­do o torso para abruptamente, o coração continua a balançar para frente como um pêndulo, movendo-se com tal força que rasga os tecidos e rompe a aorta. O sangue explode no mediastino e na cavidade da pleura.

O tórax de Jill Hewitt era um lago de sangue.

Roman sugou o sangue e então franziu as sobrancelhas ao olhar para o coração e os pulmões.

—Não consigo ver por onde ela sangrou — disse ele.

—Por que não remove todo o bloco? — perguntou seu assistente. — Teríamos melhor visibilidade.

—O rompimento parece ter sido na aorta ascendente — dis­se Jack. — Em 65 por cento das vezes, se localiza bem acima da válvula aórtica.

Roman olhou irritado para ele. Até então, conseguira ignorar Jack, mas agora se ressentia de seu comentário intrusivo. Sem dizer palavra, ele posicionou o bisturi para cortar os grandes vasos.

—Recomendo examinar o coração no lugar antes de cortar — disse Jack.

—Como e onde ela sangrou não é a nossa principal preocupação — retorquiu Roman.

Eles não se importam com o que a matou, pensou Jack. Tudo o que querem saber é qual organismo podia estar crescendo, multiplicando-se dentro dela.

Roman cortou a traqueia, o esôfago e os grandes vasos, então removeu o coração e os pulmões em um único bloco. Os pulmões estavam repletos de hemorragias. Traumáticas ou infecciosas? Jack não sabia. A seguir, Roman examinou os órgãos abdominais. O intestino delgado, assim como os pulmões, estava repleto de he­morragias mucosais. Ele o removeu e recolheu em uma vasilha. A seguir, eviscerou o estômago, o pâncreas e o fígado. Tudo seria seccionado e examinado microscopicamente. Todos os tecidos se­riam postos em cultura em busca de bactérias e vírus.

O corpo já estava desprovido de quase todos os seus órgãos internos. Jill Hewitt, piloto naval, triatleta, que gostava de uísque J&B, de apostar alto no pôquer e que adorava os filmes de Jim Carrey, não passava agora de uma casca vazia.

Roman se aprumou, parecendo um tanto aliviado. Até então, a necropsia nada revelara de inesperado. Se havia alguma prova evidente de vírus Marburg, Jack não a detectou.

Roman circundou a mesa e foi até a cabeça do cadáver.

Aquela era a parte que Jack temia. Teve de se forçar a olhar quando Roman cortou o couro cabeludo fazendo uma incisão no topo da cabeça que ia de orelha a orelha. Puxou o couro cabeludo para a frente e dobrou a aba sobre o rosto de Jill, uma franja de cabelo castanho caindo-lhe sobre o queixo. Com um fórceps, abriu o topo da caixa craniana. Nenhuma serra, nenhuma poeira de os­sos em suspensão era permitida em uma necropsia de Nível 4.

Uma massa de sangue coagulado do tamanho de um punho fechado saiu pela abertura, manchando a mesa de aço inoxidável.

—Grande hematoma subdural — disse um dos assistentes de Roman. — Teria sido provocado pelo trauma?

—Não creio — disse Roman. — Você viu a aorta... a morte ocorreu instantaneamente, no momento do impacto. Não creio que o coração tenha bombeado por tempo suficiente para produ­zir tal sangramento intracraniano.

Suavemente, ele introduziu os dedos enluvados na cavidade, sondando a superfície da massa cinzenta. Uma substância gelati­nosa escorreu dali e caiu sobre a mesa.

Roman recuou, assustado.

— Que diabos é isso?—perguntou o assistente.

Roman não respondeu. Apenas olhou para a massa de tecido. Estava coberta de uma membrana azul-esverdeada. Através desse véu brilhante, a massa parecia irregular, um emaranhado de car­ne informe. Ele estava a ponto de romper a membrana quando parou e olhou para Jack.

—É algum tipo de tumor — disse ele. — Ou cisto. Isso deve explicar a dor de cabeça de que ela se queixava.

—Não, não explica — disse Jack. — A dor de cabeça dela apareceu subitamente... em um prazo de algumas horas. Um tu­mor demora meses para crescer.

—Como sabe que ela não vinha ocultando os sintomas nos últimos meses? — rebateu Roman. — Mantendo-os em segredo para não ser excluída do lançamento?

Jack tinha de concordar que era uma possibilidade. Os astronautas queriam tanto voar que podiam ocultar qualquer sintoma que os pudesse tirar de uma missão.

Roman olhou para o colega à sua frente, no outro lado da mesa, que introduziu a massa em um recipiente de espécimes e levou-o para fora da sala.

—Não vão abri-lo? — perguntou Jack.

—Precisa ser fixado e contrastado primeiro. Se começásse­mos a cortar agora, poderíamos deformar a arquitetura celular.

—Você não sabe se é um tumor.

—E o que mais pode ser?

Jack não tinha resposta. Nunca vira algo assim antes.

Roman continuou a examinar a cavidade craniana de Jill Hewitt. Evidentemente, aquela massa, fosse o que fosse, havia au­mentado a pressão em seu cérebro, deformando as suas estrutu­ras. Há quanto tempo estaria ali? Meses, anos? Como era possível que Jill conseguisse trabalhar normalmente, quanto mais pilotar um veículo complicado como o ônibus espacial? Tudo isso passa­va pela cabeça de Jack enquanto observava Roman remover o cé­rebro e introduzi-lo em uma bacia de aço.

—Ela estava perto de um rompimento do tentório — disse Roman.

Não admira que Jill tivesse ficado cega. Não admira não ter baixado o trem de pouso. Ela já estava inconsciente, seu cérebro a ponto de sair como pasta de dente pela base do crânio.

O cadáver de Jill — ou o que restava dele — foi selado em outro saco e tirado da sala, junto com os recipientes à prova de risco patogênico que guardavam os seus órgãos.

Um segundo corpo foi trazido à mesa. Era Andy Mercer.

Usando luvas novas sobre as luvas do traje espacial e um bisturi limpo, Roman começou a fazer a incisão em Y. Agia com mais rapidez, como se Jill tivesse sido apenas o aquecimento e somente agora ele estivesse entrando no seu ritmo.

Mercer reclamara de dor abdominal e vômitos, lembrou-se Jack enquanto observava o bisturi de Roman cortar a pele e a gordura subcutânea. Mercer não se queixara de dor de cabeça, como Jill, mas tivera febre e expelira um pouco de sangue ao tos­sir. Seus pulmões apresentariam efeitos do vírus Marburg?

Outra vez, os cortes diagonais de Roman se encontraram abaixo do xifoide, e ele cortou uma linha rasa do abdome ao pú­bis. Outra vez cortou as costelas, liberando o escudo triangular que protegia o coração, e ergueu o esterno.

Ofegante, tropeçou para trás e deixou cair o bisturi, que retiniu sobre a mesa. Seus assistentes ficaram paralisados de incredu­lidade.

Na cavidade torácica de Mercer havia um aglomerado de cistos azul-esverdeados, idênticos ao cisto do cérebro de Jill Hewitt. Estavam concentrados ao redor do coração, como pequenos ovos translúcidos.

Roman ficou paralisado, o olhar fixo no tórax aberto. Então, seu olhar voltou-se para a brilhante membrana do peritônio. Es­tava distendida, repleta de sangue e projetando-se através da in­cisão abdominal.

Roman deu um passo em direção ao corpo, olhando para a proeminente membrana do peritônio. Quando ele fizera a inci­são através da parede abdominal, seu bisturi perfurara a superfí­cie da membrana, e um fluido misturado com sangue começou a verter. A princípio não passava de algumas gotas. Então, come­çou a jorrar em um fluxo contínuo. A incisão subitamente se abriu em um largo rasgão e o sangue esguichou, trazendo com ele uma inundação escorregadia de cistos azul-esverdeados.

Roman emitiu um grito horrorizado quando os cistos escorreram para o chão aglomerando-se em poças de sangue e muco.

Um deles rolou pelo chão de concreto e chocou-se contra a bota de borracha de Jack. Ele se curvou para tocá-lo com suas mãos enluvadas. Abruptamente foi puxado para trás por um dos colegas de Roman.

—Tire-o daqui! — ordenou Roman. — Tire-o da sala!

Os dois empurraram Jack em direção à porta. Ele resistiu, afastando as mãos enluvadas que agarravam seus ombros. Um deles desequilibrou-se, tropeçou em uma bandeja de instrumen­tos cirúrgicos e caiu no chão escorregadio de cistos e sangue.

O segundo homem arrancou a mangueira de ar de Jack de sua conexão e ergueu a extremidade solta.

—Eu o aconselho a sair conosco, Dr. McCallum — disse ele. — Enquanto ainda tem ar aí dentro.

—Meu traje! Meu Deus, ele rasgou!

Era o homem que tropeçara na bandeja de instrumentos, que agora olhava horrorizado para um rasgão de 5 centímetros na man­ga de seu traje espacial, que estava coberta pelos fluidos de Mercer.

—Está úmido. Posso sentir. Minha manga interna está molhada.

— Vá! — gritou Roman. Descontaminação já!

O homem tirou o traje e saiu correndo da sala, em pânico. Jack o seguiu através da porta da câmara de ar, e ambos entraram sob o chuveiro de descontaminação. A água esguichava dos jatos do teto, caindo como chuva grossa sobre seus ombros. Então, começou o banho de desinfetante, uma torrente verde que caía ruidosamente contra seus capacetes de plástico.

Quando finalmente acabou, atravessaram outra porta e tiraram os trajes. O homem arrancou o traje já seco e enfiou o braço sob uma torneira de água corrente, para lavar os fluidos corpo­rais que tivessem vazado sob a manga.

—Tem algum ferimento na pele? — perguntou Jack. — Cortes ou pele solta na raiz da unha?

—O gato de minha filha me arranhou ontem à noite.

Jack olhou para os braços do sujeito e viu marcas de garra, três linhas paralelas na parte interna do antebraço. O mesmo braço ras­gado no traje. Ele olhou para o sujeito e viu medo em seus olhos.

—O que acontece agora? — perguntou Jack.

—Quarentena. Vou ficar preso. Merda...

—Já sei que não é o Marburg — disse Jack.

O homem suspirou profundamente.

—Não. Não é.

—Então o que é? Diga-me com o que estamos lidando — disse Jack.

O homem apoiou ambas as mãos na pia e olhou para a água que escorria pelo ralo. A seguir, murmurou:

—Não sabemos.

 

Sullivan Obie dirigia sua Harley em Marte.

À meia-noite, com a lua cheia brilhando e o deser­to esburacado estendendo-se à sua frente, imaginava que o vento marciano agitàva os seus cabelos e a poeira que seus pneus levan­tava era a areia vermelha de Marte. Aquela era uma antiga fanta­sia de infância, dos tempos em que os precoces irmãos Obie lan­çavam foguetes caseiros, construíam módulos lunares de papelão e usavam trajes espaciais com papel alumínio enrugado. Dias em que ele e Gordie sabiam, simplesmente sabiam, que seu futuro era o espaço.

E é assim que acabam os grandes sonhos, pensou. Bêbado de tequila, andando de moto no deserto. Ele jamais iria a Marte. Ou à Lua. Havia a possibilidade dele sequer sair da maldita plataforma de lançamento e, em vez disso, ser instantaneamente atomizado. Uma morte rápida e espetacular. Que diabos, era melhor que morrer de câncer aos 75 anos.

Parou derrapando de lado, a motocicleta levantando poeira, e olhou para o Apogee II através das dunas iluminadas pela lua. Brilhava como um raio prateado, o cone da proa apontado para as estrelas. Fora levado à plataforma de lançamento na véspera. Tinha sido uma procissão lenta, triunfante, os 12 empregados da Apogee tocando as buzinas e batendo no teto de seus carros en­quanto seguiam o caminhão-plataforma através do deserto. Quando a nave finalmente foi erguida na posição de lançamento, todos olharam para ela, ofuscados pelo sol a pino, e ficaram ime­diatamente silenciosos.

Todos sabiam que aquela era a sua última chance. Dali a três semanas, quando o Apogee II decolasse, estaria transportando to­das as suas esperanças e sonhos.

E minha triste carcaça, pensou Sullivan.

Sentiu um calafrio ao dar-se conta de que podia estar olhan­do para o próprio ataúde.

Acelerou a Harley e voltou à estrada, pulando sobre dunas e valas. Dirigia com descaso, a imprudência abastecida por tequila e pela súbita e absoluta certeza de que já era um homem mor­to que, dali a três semanas, estaria levando aquele foguete para o esquecimento. Até então, nada podia atingi-lo, nada podia feri-lo.

A promessa da morte o tornava invencível.

Ele acelerou, voando através da árida paisagem lunar de suas fantasias infantis. E aqui estou eu, no jipe lunar, atravessando o Mar da Tranquilidade. Subindo uma colina lunar. Projetando-me para uma aterrissagem macia... Sentiu o chão lhe faltar. Sentiu-se atravessando a noite, a Harley rugindo entre seus joelhos, a lua brilhando em seus olhos. Ainda pairando no ar. Quão longe? Quão alto?

Bateu no chão com tanta força que perdeu o controle e rolou de lado. A Harley caiu em cima dele. Por um instante, ficou imó­vel, atônito, preso entre a motocicleta e uma pedra plana. Bem, que posição ridícula, pensou.

Então, a dor o atingiu, profunda e lacerante, como se seu quadril tivesse se estilhaçado.

Ele gritou e tombou de costas, o rosto voltado para o céu. A lua brilhava, debochada.

—A pélvis dele está fraturada em três partes — disse Bridget. — Os médicos colocaram pinos na noite passada. Disseram-me que vai ficar internado por um mínimo de seis semanas.

Casper Mulholland quase podia ouvir o som de seus sonhos estourando como balões.

—Seis... semanas?

—Então ficará na reabilitação durante outros três ou quatro meses.

—Quatro meses?

—Pelo amor de Deus, Cásper. Diga algo original.

—Estamos fodidos.

Bateu com a palma da mão contra a testa como se para se punir por ter ousado sonhar que poderiam ser bem-sucedidos. Era a antiga maldição da Apogee outra vez, cortando seus tendões justo quando estavam perto da linha de chegada. Explodin­do seus foguetes. Incendiando seu primeiro escritório. E, agora, tirando-lhes seu único piloto comissionado. Caminhou a esmo pela sala de espera, pensando: Nada dá certo para nós. Eles ha­viam investido todas as suas economias, bem como sua reputa­ção e seus últimos 13 anos de vida. Este era o modo de Deus lhes dizer para desistirem. Pararem com suas perdas antes que alguma coisa realmente ruim acontecesse.

— Ele estava bêbado — disse Bridget.

Cásper parou e voltou-se para ela. Estava mal-humorada, os braços cruzados, os cabelos ruivos como a aura flamejante de um anjo vingador.

—Os médicos me disseram — disse ela. — Nível de álcool no sangue de 0,19. Tão curtido quanto um arenque. Isso não é ape­nas a nossa habitual falta de sorte. É o nosso próprio Sully ferran­do tudo outra vez. Meu único consolo é que, nas próximas seis semanas, ele vai ficar com um tubo enfiado no pinto.

Sem dizer nada, Casper saiu da sala de espera, subiu o corredor e entrou no quarto de Sullivan.

—Seu idiota — disse ele.

Sully olhou-o com olhos zonzos de morfina.

—Obrigado pela gentileza.

—Você não merece gentileza alguma. Três semanas antes do lançamento e você resolve dar uma de Chuck Yeager no deserto? Por que não terminou o serviço e aproveitou para arrebentar a cabeça? Droga, não notaríamos a diferença!

Sully fechou os olhos.

—Lamento.

—Você está sempre lamentando.

—Eu ferrei tudo. Eu sei...

—Você prometeu-lhes um voo tripulado. Não foi idéia minha, foi sua. Agora, estão esperando por isso. Estão empolgados com a idéia. Quando foi a última vez que um investidor ficou interessado em nosso trabalho? Isso poderia ter feito a diferença. Se você ao menos mantivesse a garrafa arrolhada...

—Eu estava com medo.

Sully falou tão baixo que Cásper não estava certo de tê-lo ouvido direito.

—O quê? — disse ele.

—Sobre o lançamento. Tive um... pressentimento.

Um pressentimento. Lentamente, Casper afundou na cadeira ao lado da cama, toda a sua fúria imediatamente dissipada. Medo não é algo que um homem admita tão prontamente. O fato de Sully, que regularmente flertava com o perigo, confessar estar com medo abalou Casper.

E, ao menos, tornou-o mais compreensivo.

—Você não precisa de mim para o lançamento — disse Sully.

—Eles esperam que um piloto entre naquela cabine.

—Você poderia sentar um macaco no meu lugar e nem notariam a diferença. A nave não precisa de um piloto, Cap. Você pode comandá-la de terra.

Casper suspirou. Não lhes restava escolha. Teria de ser um voo não tripulado. Evidentemente tinham uma boa desculpa para não lançar Sully, mas será que os investidores aceitariam aquilo? Ou, em vez disso, achariam que a Apogee estava fraquejando? Que não tinham confiança de arriscar uma vida humana?

—Acho que perdi a minha confiança — murmurou Sully. — Bebi ontem à noite. Não consegui parar...

Casper compreendeu o medo do parceiro — do mesmo modo como compreendeu como uma derrota podia levar inexoravelmente a outra, e outra, até a única certeza na vida de uma pessoa ser o fracasso. Não admira que Sully estivesse com medo. Ele perdera a fé nos seu sonho. Na Apogee.

Talvez todos a tivessem perdido.

Casper disse:

—Ainda podemos fazer esse lançamento funcionar. Mesmo sem um macaco na cabine.

—É. Podemos mandar Bridget no lugar.

—E quem atenderia o telefone?

—O macaco.

Ambos riram. Eram como dois velhos soldados, fazendo gra­ça às vésperas de uma derrota inevitável.

—Então vamos prosseguir? — perguntou Sully. — Vamos lançar?

—Esta é a idéia quando se constrói um foguete.

—Então, tudo bem. — Sully inspirou profundamente, e uma sombra de sua antiga audácia voltou-lhe ao rosto. — Vamos fa­zer isso direito. Vamos enviar boletins para todas as agências de notícias. Uma tremenda festa ao ar livre com champanhe. Droga, convide meu santificado irmão e seus colegas da NASA. Se explo­dir na plataforma, ao menos saímos do ramo com estilo.

—É. Sempre tivemos estilo de sobra.

Eles riram.

Casper levantou-se para ir embora.

—Melhore, Sully — disse ele. — Precisaremos de você no Apogee III.

Encontrou Bridget ainda na sala de espera.

—Então? — disse ela.

—Vamos lançar na data prevista.

—Sem piloto?

Ele assentiu.

—Nos a pilotaremos da sala de controle.

Para a surpresa de Casper, ela suspirou aliviada.

—Aleluia!

—Por que está tão satisfeita? Nosso homem está imobilizado em uma cama de hospital.

—Exatamente. — Ela pendurou a bolsa no ombro e voltou-se para ir embora. — O que quer dizer que ele não estará lá para ferrar tudo.

 

11 de agosto

Nicolai Rudenko entrou na câmara de ar e observou Luther lu­tando para entrar na parte de baixo do traje de EVA. Para o pe­queno Nicolai, Luther era um gigante exótico, com aqueles om­bros largos e pernas vigorosas como pistões. E a sua pele!

Enquanto Nicolai se tornara pálido durante os meses a bordo da ISS, Luther ainda tinha uma pele de um marrom profundo e bri­lhante, um contraste marcante em comparação com os rostos macilentos que habitavam o seu mundo sem cor. Nicolai já esta­va vestido e agora pairava ao lado de Luther, pronto para ajudar o parceiro a vestir a parte de cima do traje de EVA. Pouco fala­vam um para o outro. Nenhum dos dois estava para conversa fiada.

Haviam passado uma noite sem muita conversa na câmara de ar, o que permitiu que seus corpos se ajustassem a uma pressão atmosférica mais baixa que 10,2 libras por polegada quadrada — dois terços da pressão na estação espacial. A pressão em seus trajes seria ainda menor, de 4,3. Os trajes não podiam ser inflados com uma pressão maior, ou seus membros ficariam muito rígi­dos e volumosos, e eles seriam incapazes de flexionar as juntas. Sair diretamente de uma espaçonave pressurizada para o am­biente de pressão atmosférica mais baixo de um traje de EVA era o mesmo que emergir muito rapidamente das profundezas do oceano. O astronauta podia sentir os efeitos da descompressão. Bolhas de nitrogênio se formariam no sangue, obstruindo seus vasos capilares, interrompendo o precioso fluxo de oxigênio para o cérebro e para a coluna vertebral. As consequências podiam ser devastadoras: paralisia e derrame cerebral. Como mergulhadores de águas profundas, os astronautas precisavam dar aos seus cor­pos tempo para que se ajustassem às mudanças de pressão. Na noite anterior a um passeio no espaço, a equipe de EVA inundava os pulmões com 100 por cento de oxigênio e se fechava na câma­ra de descompressão para "acampar". Durante horas, eram en­cerrados em uma câmara apertada, já repleta de equipamentos. Não era lugar para claustrofóbicos.

Estendendo os braços acima da cabeça, Luther esgueirou-se para dentro da sólida armadura peitoral, que estava presa à pare­de da câmara de ar. Era uma dança exaustiva, como se arrastar por um túnel por demais estreito. Por fim, sua cabeça saiu pelo buraco do pescoço, e Nicolai ajudou-o a fechar a junta da cintu­ra, selando as duas metades do traje.

Vestiram os capacetes. Quando Nicolai olhou para baixo para encaixar o capacete à armadura peitoral, percebeu algo brilhante na borda da junta do pescoço. Apenas cuspe, pensou, e trancou o capacete. Calçaram as luvas. Isolados em seus trajes, abriram a escotilha da câmara de equipamentos, flutuaram para o cômodo anexo e fecharam a escotilha atrás de si. Estavam agora em um compartimento ainda menor, onde quase não cabiam os dois as­tronautas e o volumoso equipamento de sobrevivência.

Seguiram-se trinta minutos de "pré-respiração". Enquanto inspiravam oxigênio puro, expurgando do sangue qualquer vestí­gio de nitrogênio, Nicolai flutuava de olhos fechados, preparando-se mentalmente para o passeio no espaço que viria a seguir. Se eles não conseguissem liberar a junta rotacional, se não pudessem reo­rientar os painéis solares em direção ao sol, ficariam sem energia. Aleijados. O que Nicolai e Luther conseguissem fazer nas próximas seis horas bem poderia determinar o destino da estação espacial.

Embora a responsabilidade pesasse sobre seus ombros cansados, Nicolai estava ansioso para abrir a escotilha e flutuar para fora da estação. Fazer uma EVA era como nascer outra vez, o feto emergindo daquela abertura pequena e estreita, o cordão umbili­cal balançando à medida que saía na vastidão do espaço. Não fos­se tão grave a situação, estaria ansioso para fazer aquilo, excitado para ganhar a liberdade de flutuar em um universo sem paredes, a incrível Terra azul girando lá embaixo.

Mas as imagens que lhe vinham à mente enquanto esperava de olhos fechados a passagem daqueles trinta minutos nada tinham a ver com um passeio no espaço. O que via em vez disso era a face da morte. Ele imaginava a Discovery baixando do céu. Via a tripulação, atada às suas poltronas, corpos chacoalhando como bonecos, colunas vertebrais se rompendo, corações explodindo. Embora o Controle da Missão não tivesse fornecido detalhes da catástrofe, aquelas visões de pesadelo preenchiam-lhe a mente, faziam seu coração bater forte e sua boca ficar seca.

— Seus trinta minutos acabaram, rapazes — disse a voz de Emma pelo interfone. — Hora de despressurizar.

Com mãos úmidas de suor, Nicolai abriu os olhos e viu Luther acionar a bomba de despressurização. O ar estava sendo sugado para fora, a pressão ambiente baixando lentamente. Se hou­vesse algum vazamento em seus trajes, seria então detectado.

—Tudo bem? — perguntou Luther, verificando os fechos de seus cordões umbilicais.

—Estou pronto.

Luther deixou a atmosfera do compartimento vazar para o espaço. Então, liberou a trava e abriu a escotilha.

O ar remanescente sibilou ao escapar.

Fizeram uma pausa, agarrando a borda da escotilha, olhan­do admirados para fora. Então, Nicolai saiu para a escuridão do espaço.

—Eles estão saindo — disse Emma, acompanhando no circuito fechado de TV a saída dos dois astronautas atados aos seus cor­dões umbilicais.

Eles removeram as ferramentas da caixa que ficava do lado de fora da escotilha. Então, de apoio em apoio, avançaram em direção à estrutura principal de painéis solares. Ao passar pela câmera ins­talada sob a estrutura, Luther acenou.

—Estão assistindo ao show? — disse através do sistema de áudio UHF.

—Nós o vemos bem pela câmera externa — disse Griggs. — Mas suas câmeras EMU não estão transmitindo.

—A de Nicolai também não?

—De nenhum dos dois. Vamos tentar descobrir qual é o problema.

—Tudo bem, vamos até a estrutura para verificar os danos.

Os dois saíram do campo de visão da primeira câmera. Por um instante, desapareceram de vista. Então Griggs disse:

—Lá estão eles.

E apontou para outra tela, na qual viam os astronautas movendo-se em direção à segunda câmera, avançando ao longo do topo da estrutura. Mais uma vez sumiram de vista. Agora esta­vam na área cega da câmera danificada e não podiam ser vistos.

—Estão perto, rapazes? — perguntou Emma.

—Quase... estamos quase lá — disse Luther, soando ofegante.

Devagar, pensou Emma. Vão devagar.

Durante um tempo aparentemente interminável, nada ouviram da equipe de EVA. Emma sentiu o pulso acelerar e a ansieda­de aumentar. A estação já estava danificada e sem energia. Nada podia dar errado durante os reparos. Se ao menos Jack estivesse aqui, pensou. Jack era um faz-tudo talentoso que podia recons­truir qualquer motor de barco ou fazer um rádio de ondas curtas a partir de peças de ferro-velho. Em órbita, as ferramentas mais valiosas eram um par de mãos habilidosas.

—Luther? — chamou Griggs.

Não houve resposta.

—Nicolai? Luther? Por favor respondam.

—Merda — disse Luther.

—O que foi? O que veem? — perguntou Griggs.

—Estou olhando para o problema e, cara, está uma droga. Toda a extremidade P-6 da estrutura principal está retorcida. A Discoverydeve ter enganchado no painel 2-B e curvado aquela extremidade para cima. Então, virou de lado e quebrou as ante­nas de banda S.

—O que você acha? Dá para consertar alguma coisa?

—As antenas de banda S não são problema. Temos um ORU para as antenas e apenas as substituiremos. Mas os painéis solares de bombordo... podem esquecer. Precisamos de uma estrutura nova naquela extremidade.

—Tudo bem. — Cansado, Griggs esfregou o rosto. — Bem, então estamos definitivamente sem um PVM. Acho que podemos lidar com isso. Mas precisamos que os painéis P-4 sejam re­orientados, ou estaremos ferrados.

Houve uma pausa enquanto Luther e Nicolai voltavam ao longo da estrutura principal. Subitamente, entraram na área de cobertura da câmera. Emma os viu passarem lentamente dentro de seus trajes volumosos com mochilas enormes às costas, como mergulhadores de águas profundas movendo-se debaixo d'água. Pararam nos painéis P-4. Um deles flutuou até o lado da estrutu­ra e olhou para o mecanismo que unia os enormes painéis solares à estrutura.

—A junta rotacional está emperrada — disse Nicolai. — Não gira.

—Consegue soltá-la? — perguntou Griggs.

Ouviram um breve diálogo entre Luther e Nicolai. Então Luther disse:

—Quão elegantemente querem que esse trabalho seja feito?

— Do jeito que for possível. Precisamos disso logo ou estaremos em apuros, rapazes.

—Acho que podemos tentar uma abordagem de lanterneiro.

Emma olhou para Griggs.

—Ele disse o que eu estou pensando?

Foi Luther quem respondeu:

—Vamos pegar uma marreta e martelar esse negócio de volta ao lugar.

Ele ainda estava vivo.

O Dr. Isaac Roman olhou através da janela de observação para o infeliz colega sentado em uma cama hospitalar assistindo à TV. Desenhos animados, acredite se quiser. Canal Nickelodeon, para o qual o paciente olhava com concentração quase desespera­da. Ele sequer olhou para a enfermeira com traje espacial que entrou na sala para remover a bandeja intocada do almoço.

Roman apertou o botão do interfone.

—Como está se sentindo hoje, Nathan?

O Dr. Nathan Helsinger voltou o olhar assustado para a jane­la e somente então notou que Roman estava do outro lado do vidro.

—Estou bem. Estou perfeitamente saudável.

—Não manifestou nenhum sintoma?

—Já disse, estou bem.

Roman observou-o um instante. O sujeito parecia bem saudável, mas seu rosto estava pálido e tenso. Com medo.

—Quando posso sair do isolamento? — disse Helsinger.

—Mas só se passaram trinta horas.

—Os astronautas manifestaram sintomas em 18 horas.

—Isso em microgravidade. Não sabemos o que esperar aqui e não podemos arriscar. Você sabe disso.

Helsinger voltou-se abruptamente para a TV, mas não antes que Roman visse o brilho das lágrimas em seus olhos.

—Hoje é aniversário de minha filha.

—Enviamos um presente em seu nome. Sua esposa foi informada que você não poderia comparecer. Que você está em um avião para o Quênia.

Helsinger riu com amargura.

—Vocês não deixam ponto sem nó, não é mesmo? E se eu morrer? O que dirão?

—Que aconteceu no Quênia.

—Um lugar tão adequado quanto qualquer outro, suponho. — Ele suspirou. — O que deram para ela?

—Para a sua filha? Acho que foi uma Dra. Barbie.

—Era exatamente o que ela queria. Como sabiam?

O celular de Roman tocou.

Falo com você depois — disse ele, então se afastou da janela para atender o telefone.

—Dr. Roman, é o Carlos. Temos alguns resultados de DNA. Devia subir para ver isso.

—Estou a caminho.

Encontrou o Dr. Carlos Mixtal sentando diante do computador do laboratório. Os dados rolavam pelo monitor em um fluxo contínuo:

 

GTGATTAAAGTGGTTAAAGTTGCTCATGTTCAATTATGCA-GTTGTTGCGGTTGCTTAGTGTCTTTAGCAGACACATAT-GAAAAGCTTTTAGATGTTTTGAATTCAATTGAGTTGGTTTATTGTCAAACTTTAGCAGATGCAAGAGAAATTCCTGAATGCGATATTGCTTTAGTTGAA GGCTCTGT...

 

Os dados constavam de apenas quatro letras, G, T, A, e C. Era um sequência de nucleotídeos, e cada uma das letras representava os blocos formadores do DNA, a matriz genética de todo organismo vivo.

Carlos virou-se ao ouvir os passos de Roman, e a expressão em seu rosto era inconfundível. Carlos parecia estar amedrontado. Igual a Helsinger, pensou Roman. Todo mundo está com medo.

Roman sentou-se ao lado dele.

É isso? — perguntou, apontando para a tela.

Esse é o organismo que infectou Kenichi Hirai. Retiramos o material dos restos que conseguimos... raspando das paredes da Discovery.

Restos era uma palavra apropriada para o que sobrara do corpo de Hirai. Massas de tecido esfacelado, grudadas às paredes do veículo orbital.

—A maior parte do DNA permanece não identificável. Não fazemos idéia do que codifica. Mas esta sequência em particular aqui na tela nós pudemos identificar. É o gene da coenzima F420.

—O que é isso?

—Uma enzima específica de Archaeons.

Roman recostou-se na cadeira, sentindo-se levemente nauseado.

—Então, está confirmado — murmurou.

—Sim. O organismo definitivamente tem um DNA de Archaeon.— Carlos fez uma pausa. — Infelizmente, tenho más no­tícias.

—O que quer dizer com "más notícias"? Isso, por si só, já não é ruim o bastante?

Carlos digitou algo no teclado, e a sequência de nucleotídeos passou para um segmento diferente.

—Este é outro gene que encontramos. A princípio, pensei que fosse um engano, mas a coisa acabou se confirmando. Bate com o de uma Rana pipiens. A rã-leopardo do norte.

—O quê?

—Exato. Só Deus sabe como o organismo adquiriu esse gene de sapo. Agora, a coisa fica realmente assustadora. — Carlos ro­lou a tela até outro segmento do genoma. — Outro grupo identi­ficável — disse ele.

Roman sentiu um calafrio subir-lhe pela espinha.

—E que genes são esses?

—Esse DNA é específico de um Mus musculis. O rato co­mum.

Roman olhou para o colega.

— Isso é impossível.

—Eu confirmei. Esta forma de vida de algum modo incorporou DNA de mamíferos em seu genoma. Acrescentou novas ca­pacidades enzimáticas. Está mudando. Evoluindo.

Para se tornar o quê?, perguntou-se Roman.

—Há mais. — Outra vez, Carlos digitou no teclado, e outra sequência de bases de nucleotídeos passou pelo monitor. — Este segmento também não veio de um Archaeon.

—O que é? Mais DNA de rato?

—Não. Esta parte é humana.

Roman sentiu um calafrio na espinha. Os cabelos de sua nuca se eriçaram. Atônito, procurou o telefone.

—Ligue-me com a Casa Branca — disse ele. — Preciso falar com Jared Profitt.

Sua chamada foi atendida no segundo toque.

— Fala Profitt.

—Nós analisamos o DNA — disse Roman.

—E?

—A situação é pior do que pensávamos.

 

Nicolai fez uma pausa para descansar, braços trê­mulos de fadiga. Após meses no espaço, seu cor­po enfraquecera, e ele se desacostumara ao esforço físico. Em microgravidade, não há como erguer pesos, e os músculos pouco se exercitam. Nas últimas cinco horas, ele e Luther haviam traba­lhado sem parar. Consertaram as antenas de banda S, desmonta­ram e remontaram a junta rotacional. Agora, ele estava exausto. O simples ato de dobrar os braços dentro do volumoso traje de EVA dificultava as mais simples tarefas.

Trabalhar dentro do traje era um experiência penosa. Para isolar o corpo humano de temperaturas extremas, que variavam de - 418 a - 482 graus centígrados, e para manter a pressão contra o vácuo do espaço, o traje era feito de múltiplas camadas: isolan­te aluminizado Mylar, náilon à prova de rasgaduras, uma cober­tura Ortho-fabric e uma camada inflada de náilon coberto de uretano. Dentro do traje, o astronauta vestia uma ceroula reco­berta de tubos de refrigeração à água. Também tinha de usar uma mochila de sobrevivência contendo água, oxigênio, um pacote de foguetes para auto-resgate e equipamento de rádio. Em essência, o traje de EVA era uma espaçonave pessoal, volumosa e difícil de manobrar, e apenas o ato de apertar um parafuso exigia esforço e concentração.

O trabalho exaurira Nicolai. Sentia cãibras nos dedos e estava suando por baixo das luvas espaciais.

Também estava com fome.

Sugou um gole de água do bico instalado dentro do traje e emitiu um profundo suspiro. Embora a água tivesse um gosto esquisito, quase de peixe, ele não se abalou. Tudo tinha gosto es­tranho em microgravidade. Tomou outro gole e sentiu que mo­lhara o queixo. Não podia introduzir a mão no capacete para se enxugar, de modo que ignorou o incidente e olhou para a Terra lá embaixo. Aquela rápida visão do planeta, com toda a sua gló­ria, o fez se sentir um pouco tonto, um tanto nauseado. Nicolai fechou os olhos, esperando a sensação passar. Era apenas cinetose, nada mais. Acontecia sempre que, inesperadamente, alguém olhava para a Terra. A medida que o estômago se acomodava, deu-se conta de outra sensação: a água que derramara estava su­bindo pelo seu rosto. Ele fez uma careta tentando afastar a gota, mas aquilo continuou a subir pelo seu rosto.

Mas estou em microgravidade, onde não há em cima ou embai­xo. A água não devia estar escorrendo.

Começou a balançar a cabeça e bateu com a mão enluvada no capacete.

Voltou a sentir a gota subindo por seu rosto, traçando uma linha úmida sobre o seu maxilar. Em direção ao seu ouvido. Já chegara à borda do gorro que fixava a unidade de comunicação. Certamente o tecido absorveria a umidade, evitaria que conti­nuasse escorrendo...

Imediatamente seu corpo enrijeceu. A umidade entrara por baixo da borda do gorro. Estava agora se esgueirando em direção ao seu ouvido. Não era uma gota de água e nem um rastro de umidade, mas algo que estava se movendo por conta própria. Algo vivo.

Ele se voltou para a esquerda, depois para a direita, tentando deslocá-la. Bateu com força no capacete. Ainda assim, sentiu-a se mover, esgueirando-se por baixo da unidade de comunicação.

Olhou para a Terra, então para o espaço e voltou a olhar para a Terra, enquanto se debatia e se revirava em movimentos frené­ticos.

A gota entrara em seu ouvido.

—Nicolai? Nicolai, por favor responda! — disse Emma, observando-o no monitor de TV.

Ele rodopiava, as mãos enluvadas batendo freneticamente no capacete.

Luther, ele parece estar tendo um ataque!

Luther apareceu na câmera, movendo-se com rapidez em direção ao seu colega de EVA. Nicolai continuava a se debater, ba­lançando a cabeça para a frente e para trás. Emma podia ouvi-los em UHF. Luther perguntava, ansioso:

—O que foi? O que foi?

—Meu ouvido... Está no meu ouvido.

—Dói? Seu ouvido dói? Olhe para mim!

Nicolai voltou a bater no capacete.

—Está entrandol—gritou. — Tire isso de mim! Tire isso de mim!

—O que há de errado com ele? — gritou Emma.

—Eu não sei! Meu Deus, ele está em pânico.

—Ele está muito perto do poste de ferramentas. Tire-o daí antes que danifique o traje!

No monitor de TV, Luther segurou o parceiro pelo braço.

—Vamos, Nicolai! Vamos voltar à estação.

Subitamente Nicolai agarrou o capacete, como se para arrancá-lo.

—Não! Não faça isso! —gritou Luther, segurando ambos os braços do parceiro em uma tentativa desesperada de contê-lo. Rolaram juntos, os cordões umbilicais emaranhando-se ao seu redor.

Griggs e Diana se juntaram a Emma diante do monitor de TV e os três observaram, horrorizados, o drama que se desenrolava do lado de fora da estação.

—Luther, o poste de ferramentas! — disse Griggs. — Cuida­do com seus trajes!

Neste exato momento, Nicolai voltou-se súbita e violentamente para se livrar de Luther. Seu capacete bateu no poste de ferramentas. Um jato fino de algo que parecia ser uma névoa branca imediatamente escapou pela viseira.

—Luther! — gritou Emma. — Verifique o capacete dele! Verifique o capacete dele!

Luther olhou para a viseira de Nicolai.

—Merda, está rachada! — gritou. — Posso ver o ar escapan­do! Ele está descomprimindo!

—Acione o 02 de emergência e tire-o daí agora!

Luther estendeu a mão e apertou o botão que acionava o suprimento de oxigênio de emergência no traje do parceiro. O flu­xo extra de ar manteria o traje inflado tempo o bastante para que Nicolai fosse trazido de volta com vida. Ainda lutando para con­tê-lo, Luther começou a arrastá-lo para a escotilha.

—Rápido — murmurou Griggs. — Meu Deus, rápido.

Passaram preciosos minutos até Luther conseguir arrastar Nicolai até a cabine, até a escotilha ser fechada e a atmosfera pres­surizada. Não esperaram a verificação habitual da integridade da câmara. Em vez disso, a pressurizaram imediatamente em uma atmosfera.

A escotilha se abriu e Emma atravessou a câmara de equipamento.

Luther já havia removido o capacete de Nicolai e tentava desesperadamente arrancar a armadura peitoral. Trabalhando jun­tos, tiraram um Nicolai rebelde de dentro do traje de EVA. Emma e Griggs o arrastaram pela estação até o RSM, onde havia a ener­gia e a luz estavam normalizadas. Ele gritou durante todo o per­curso, agarrando o lado esquerdo de seu gorro com comunica­dor. Seus olhos estavam fechados e inchados, as pálpebras intumescidas. Ela tocou-lhe as faces e sentiu ar aprisionado no tecido subcutâneo devido à descompressão. Um linha de saliva brilhava em seu queixo.

—Nicolai, acalme-se! — disse Emma. — Você está bem, está me ouvindo? Você vai ficar bem!

Ele gritou e arrancou o gorro, que saiu voando.

—Ajudem-me a colocá-lo na maca! — disse Emma.

Foram necessárias todas as mãos disponíveis para preparar a maca de contenção, tirar os tubos de ventilação de Nicolai e amarrá-lo. Agora, ele estava completamente imobilizado. Enquanto Emma auscultava-lhe o coração e os pulmões e examina­va-lhe o abdome, ele continuava a gemer e a virar a cabeça de um lado para o outro.

—É o ouvido — disse Luther, que se livrara do volumoso traje de EVA e olhava de olhos arregalados para o atormentado Nicolai. — Ele disse que era algo em seu ouvido.

Emma olhou mais de perto para o rosto de Nicolai. Para a linha de saliva que saía de seu queixo e contornava a curva do maxilar. Em direção ao ouvido. Havia uma gota de umidade na parte externa do ouvido.

Ela ligou o otoscópio movido a bateria e inseriu a ponta no canal auricular de Nicolai.

A primeira coisa que viu foi sangue. Uma gota, brilhando à luz do otoscópio. Então, Emma se concentrou no tímpano.

Estava perfurado. Em vez do brilho da membrana timpânica, viu um orifício negro. Trauma da descompressãofoi a primeira coisa que pensou. Teria a súbita descompressão estourado os tímpanos de Nicolai? Ela verificou o outro tímpano. Este, porém, estava intacto.

Confusa, desligou o otoscópio e olhou para Luther.

—O que aconteceu lá fora?

—Eu não sei. Ambos estávamos descansando um pouco an­tes de trazermos as ferramentas de volta. Em um minuto ele estava bem, no outro, entrou em pânico.

—Preciso ver o capacete dele.

Ela deixou o RSM e foi até a câmara de equipamentos. Abriu a escotilha, entrou e examinou ambos os trajes de EVA, que Luther havia recolocado na parede.

—O que está fazendo, Watson? — perguntou Griggs, que a seguira.

—Quero ver o tamanho da rachadura. Quão rapidamente ele descomprimiu.

Foi até o traje de EVA menor, com o nome "Rudenko", e removeu o capacete. Olhando lá dentro, viu algo úmido grudado na viseira rachada. Pegou um cotonete de um de seus bolsos e levou a ponta ao fluido. Era grosso e gelatinoso. Azul-esverdeado.

Um calafrio percorreu-lhe a espinha.

Kenichi esteve aqui, lembrou-se de repente. Na noite em que morreu, nós o encontramos nesta câmara. De algum modo ele a contaminou.

Imediatamente, Emma recuou, em pânico, colidindo com Griggs na escotilha.

—Fora! — gritou. — Saia daqui!

—O que foi?

—Acho que temos risco de contaminação! Feche a escotilha! Feche!

Deixaram a câmara e entraram no nodo. Juntos, fecharam a escotilha e a vedaram. Trocaram olhares tensos.

—Acha que vazou alguma coisa? — perguntou Griggs.

Emma vasculhou o nodo, procurando gotículas pairando no ar. A primeira vista, nada encontrou. Então, viu um relance de movimento, um brilho, que parecia tremular na mais extrema periferia de sua visão.

Ela se voltou para olhar, mas o brilho já havia desaparecido.

Jack sentou-se diante de seu console na sala de Operações de Veí­culo Especial, a tensão crescendo a cada minuto enquanto obser­vava o relógio na tela principal. As vozes que ouvia pelo fone de ouvido falavam com urgência renovada, a conversa rápida e em staccato à medida que os relatórios da situação eram passados en­tre os controladores e o diretor de vôo da ISS, Woody Ellis. Seme­lhante em disposição à Sala de Controle Vôo do ônibus espacial e instalada no mesmo edifício, a sala do SVO era menor, uma ver­são mais especializada, controlada por uma equipe dedicada ape­nas às operações da estação espacial. Nas últimas 36 horas, desde que a Discoverycolidira com a ISS, aquela sala fora palco de ansiedade crescente, temperada com pânico intermitente. Com tanta gente na sala, tantas horas ininterruptas de estresse, o pró­prio ar cheirava a crise, uma mistura dos odores de suor e café requentado.

Nicolai Rudenko sofria dos males da descompressão e evidentemente tinha de ser resgatado. Por haver apenas um bote salva-vidas — O Veículo de Retorno de Tripulação —, toda a tripulação teria de voltar para casa. Seria uma evacuação controlada. Sem ata- lhos, sem erros. Sem pânico. A NASA fizera aquela simulação di­versas vezes, mas uma evacuação por CRV nunca fora realizada de verdade. Não com cinco seres humanos a bordo.

Não com alguém que amo a bordo.

Jack suava e estava quase nauseado de tanto medo.

Olhava para o relógio na tela a toda hora e comparava-o com seu relógio de pulso. Esperavam que a trajetória orbital da ISS chegasse à posição certa antes que pudessem proceder à separa­ção do veículo. O objetivo era descer o CRV do modo mais direto possível em um local de aterrissagem imediatamente acessível às equipes médicas. Toda a tripulação precisaria de assistência. De­pois de semanas no espaço, estariam fracos como gatinhos re­cém-nascidos, os músculos incapazes de sustentá-los.

O momento da separação se aproximava. Demoraria 25 minutos para se afastarem da ISS e adquirirem orientação por GPS, 15 minutos para a sequência de queima de combustível para saí­da de órbita. Uma hora para aterrissarem.

Em menos de duas horas, Emma estaria de volta à Terra. De um modo ou de outro. O pensamento ocorreu-lhe antes que pu­desse afastá-lo. Antes que pudesse evitar se lembrar da terrível visão do corpo despedaçado de Jill Hewitt na mesa de autópsia.

Fechou as mãos em punho, forçando-se a se concentrar nas leituras de biotelemetria de Nicolai Rudenko. Os batimentos car­díacos estavam rápidos, embora regulares, e a pressão arterial continuava estável. Vamos, vamos. Agora, nós os traremos de volta para casa.

Ouviu Griggs informar:

Capcom, minha tripulação está a bordo do CRV e a escotilha está fechada. Está um pouco apertado aqui, mas estaremos prontos quando vocês estiverem.

Aguardem o momento de acionar — disse Capcom.

Estamos aguardando.

—Como vai o paciente?

O coração de Jack acelerou ao ouvir a voz de Emma:

— Suas funções vitais continuam estáveis, mas ele está muito desorientado. A crepitação migrou para o pescoço e para o peito, e está lhe causando algum desconforto. Dei-lhe outra dose de morfina.

A súbita descompressão provocara bolhas de ar em seus tecidos macios. Tal condição era inofensiva, embora dolorosa. O que preocupava Jack eram as bolhas de ar no sistema nervoso. Seria por isso que Nicolai estava confuso?

Woody Ellis disse:

—Preparem-se para acionar. Removam os selos ECCLES.

—ISS — disse o Capcom — Vocês estão autorizados a...

—Suspendam o procedimento! — interrompeu uma voz.

Jack olhou confuso para o diretor de vôo Ellis, que parecia tão confuso quanto ele. Ellis voltou-se e topou com o diretor do JSC, Ken Blankenship, que acabara de entrar na sala, acompanhado de um sujeito de terno com cabelos escuros e mais meia dúzia de oficiais da Força Aérea.

—Desculpe, Woody — disse Blankenship. — Acredite, não foi decisão minha.

—Que decisão? — disse Ellis.

—O resgate foi cancelado.

—Temos um homem doente lá em cima! O CRV está pronto para partir e...

—Eles não podem voltar.

—E quem tomou tal decisão?

O homem de cabelos escuros deu um passo adiante e disse, quase pedindo desculpas:

—A decisão é minha. Sou Jared Profitt, Conselho de Segurança da Casa Branca. Por favor, diga para a sua tripulação voltar a abrir as escotilhas e deixar o CRV.

—Minha tripulação está em apuros — disse Ellis. — Vou trazê-los para casa.

O encarregado da trajetória interrompeu:

Vôo, teremos de separar agora se quisermos que aterris­sem no alvo.

Ellis meneou a cabeça para o Capcom.

—Acionar CRV. Vamos proceder à separação.

Antes que o Capcom pudesse dizer outra palavra, seu fone de ouvido foi arrancado e ele foi arrastado de sua cadeira. Um oficial da Força Aérea tomou o lugar do Capcom ao console.

—Ei! — gritou Ellis. — Ei!

Todos os controladores de voo ficaram paralisados enquanto os outros oficiais da Força Aérea imediatamente se espalhavam pela sala. Nenhuma arma foi sacada, mas a ameaça era evidente.

—ISS, não acione o CRV — disse o novo Capcom. — O resgate foi cancelado. Voltem a abrir as escotilhas e deixem o CRV.

Atônito, Griggs respondeu:

—Acho que não entendi, Houston.

—O resgate foi cancelado. Deixem o CRV. Estamos tendo dificuldades com os computadores de TOPO e GNC. O comando de vôo decidiu que será melhor adiar a evacuação.

—Por quanto tempo?

—Indefinidamente.

Jack levantou-se da cadeira, pronto para arrancar o fone de ouvido do novo Capcom.

Jared Profitt subitamente apareceu à sua frente, barrando-lhe a passagem.

—O senhor não compreende a situação.

—Minha mulher está naquela estação. Vamos trazê-la de volta para casa.

—Eles não podem voltar. Podem estar todos infectados.

—Com o quê?

Profitt não respondeu.

Furioso, Jack avançou para cima dele, mas foi contido por dois oficiais da Força Aérea.

— Infectados com o quê? —gritou Jack.

—Um novo organismo — disse Profitt. — Uma quimera.

Jack olhou para o rosto aflito de Blankenship. Olhou para os oficiais da Força Aérea, prontos para assumirem o controle dos consoles. Então, notou outro rosto familiar: o de Leroy Cornell, que acabara de entrar na sala. Cornell parecia pálido e trêmulo. Foi quando Jack compreendeu que aquela decisão fora tomada pelo alto-comando. Que nada que ele, Blankenship ou Woody Ellis dissessem faria alguma diferença.

A NASA já não estava mais no controle.

 

A Quimera

13 de agosto

Reuniram-se na casa de Jack, com todas as cortinas fechadas. Não ousaram se encontrar no JSC, onde certamente seriam notados. Estavam tão atônitos com a súbita apropriação das operações da NASA que não tinham idéia de como proceder. Aquela era uma crise para a qual não tinham ma­nual de operações, nenhum plano de contingência. Jack convidara apenas algumas pessoas, todas envolvidas com as operações da NASA: Todd Cutler, Gordon Obie, os diretores de vôo Woody Ellis e Randy Carpenter, e Liz Gianni, da Diretoria de Carga Útil.

A campainha tocou e todos ficaram tensos.

—É ele — disse Jack antes de abrir a porta.

O Dr. Eli Petrovitch, da Superintendência de Ciências Naturais da NASA, entrou, carregando uma pasta de laptop. Era um ho­mem magro e frágil que, nos últimos dois anos, vinha lutando contra um linfoma. Obviamente estava perdendo a guerra. A maior parte de seu cabelo caíra, restando apenas uns tufos esbranquiçados. Sua pele parecia pergaminho amarelado, esticado sobre os ossos proeminentes da face. Mas seus olhos brilhavam de excitação, ilu­minados pela infatigável curiosidade dos cientistas.

—Conseguiu? — perguntou Jack.

Petrovitch meneou a cabeça e deu um tapinha na pasta. Naquele rosto esquelético, seu sorriso parecia fantasmagórico.

—O USAMRIID concordou em compartilhar um pouco de seus dados.

—Um pouco?

—Nem tudo. A maior parte do genoma permanece confidencial. Nos deram apenas partes da sequência, com grandes va­zios entre uma e outra. Estão nos mostrando apenas o suficiente para provarem que a situação é grave.

Levou o laptop até a mesa da sala de jantar e o abriu. Quando todos se reuniram para olhar, Petrovitch ligou o computador e, então, introduziu-lhe um disco flexível.

Os dados começaram a deslizar na tela, linha após linha de letras aparentemente aleatórias passando em um ritmo vertigino­so. Não era um texto. Aquelas letras não enunciavam palavras, mas sim um código. As mesmas quatro letras se repetiam indefi­nidamente, em sequência alternada: A, T, G e C. Representavam nucleotídeos adeninas, timinas, guaninas e citosinas. Os tijolos que compõem o DNA. Aquela sequência de letras era um geno­ma, a matriz química de um organismo vivo.

—Isto é a quimera deles — disse Petrovitch. — O organismo que matou Kenichi Hirai.

— E o que vem a ser essa tal "quimera"? — perguntou Randy Carpenter. — Poderia explicar para nós, engenheiros ignorantes?

—Claro — disse Petrovitch. — E não há por que se sentir ignorante. Não é um termo muito usado fora da biologia molecular. A palavra vem da Grécia Antiga. A Quimera era um monstro mi­tológico, supostamente imbatível. Uma criatura que punha fogo pelas ventas com cabeça de leão, corpo de bode e cauda de serpen­te. Acabou morta pelo herói Belerofonte. Não foi exatamente uma luta justa, porque ele trapaceou. O herói pegou uma carona em Pégaso, o cavalo alado e, lá de cima, a matou a flechadas.

—Interessante toda essa mitologia — interrompeu Carpenter, impaciente. — Mas qual é a relevância da informação?

—A quimera grega era uma criatura bizarra feita de três animais diferentes. Leão, bode e serpente combinados em um único ser. E isso é exatamente o que estamos vendo aqui, nestes cro­mossomos. Uma criatura tão bizarra quanto o monstro morto por Belerofonte. Esta é uma quimera biológica, cujo DNA vem de ao menos de três espécies distintas.

—Você consegue identificar tais espécies? — perguntou Carpenter.

Petrovitch assentiu.

—Ao longo dos anos, os cientistas do mundo inteiro reuni­ram uma biblioteca de sequências de genes de diversas espécies, de vírus a elefantes. Contudo, reunir tal informação é um trabalho lento e tedioso. Demoraram décadas apenas para analisar o genoma humano. Portanto, como você pode imaginar, há diver­sas espécies cujo genoma não foi decodificado. Grandes partes do genoma da quimera não podem ser identificadas. Não fazem par­te da biblioteca. Mas aqui está o que conseguimos identificar até agora.

Ele clicou sobre o ícone "espécies identificadas".

Na tela, apareceu:

Mus musculis (rato comum)

Ranapipiens (rã-leopardo do norte)

Homo sapiens

—Este organismo é parte rato, parte anfíbio e parte humano. — Ele fez uma pausa. — De certo modo, o inimigo somos nós.

A sala ficou em silêncio.

—Qual gene humano está neste cromossomo? — perguntou Jack em voz baixa. — Qual parte da quimera é humana?

—Pergunta interessante — disse Petrovitch, assentindo em sinal de aprovação. — Merece uma resposta interessante. Você e o Dr. Cutler vão gostar do que diz esta lista.

Ele digitou algo no teclado e, na tela, apareceu:

Amilase

Lipase

Fosfolipase A

Tripsina

Quimotripsina

Elastase

Enteroquinase

 

—Meu Deus — murmurou Todd Cutler. — São enzimas digestivas.

O organismo está programado para devorar seus hospedeiros, pensou Jack. Usa as enzimas para nos digerir de dentro para fora, reduzindo nossos músculos, órgãos e tecidos conjuntivos a pouco mais que uma sopa fedorenta.

Jill Hewitt... ela nos disse que o corpo de Hirai havia se desintegrado — disse Randy Carpenter. — Achei que ela estava tendo alucinações.

Subitamente, Jack disse:

—Isso deve ser um organismo de bioengenharia! Alguém preparou isso em um laboratório. Pegou uma bactéria ou vírus e acrescentou genes de outras espécies, para torná-lo uma máquina mortal mais eficiente.

—Mas qual bactéria? Qual vírus? — perguntou Petrovitch. —Este é o mistério aqui. Sem mais partes do genoma para exami­nar, não podemos identificar com quais espécies começaram. O USAMRIID se recusa a nos revelar a parte mais importante do cromossomo deste organismo. A parte que identifica o assassino. — Ele olhou para Jack. — Você é o único aqui que viu a patologia em necropsia.

—Apenas de relance. Eles me tiraram da sala tão rapidamen­te que mal pude olhar. O que vi parecia ser algum tipo de cisto. Do tamanho de pérolas, envoltas em uma matriz azul-esverdeada. Estavam no tórax e no abdome de Mercer. No crânio de Hewitt. Nunca vi nada parecido antes.

—Poderiam ser cistos hidátides? — disse Petrovitch.

—O que é isso? — perguntou Woody.

—E uma infecção causada pelo estado larval de uma tênia chamada equinococo. Provoca cistos no fígado e nos pulmões. Portanto, em qualquer órgão.

—Você acha que isso pode ser um parasita?

Jack balançou a cabeça.

—Os cistos hidátides demoram muito para se desenvolver. Anos e não dias. Não creio que seja um parasita.

—Talvez não fossem cistos — disse Todd. — Talvez fossem esporos. Bolas de fungos. Aspergilos ou criptococos.

Liz Gianni, de Cargas Úteis, atalhou:

—A tripulação reportou um problema de contaminação por fungos. Uma das experiências teve de ser destruída por causa de proliferação excessiva.

—Qual experiência? — perguntou Todd.

—Terei de verificar. Lembro-me que foi uma das culturas de células.

—Mas uma simples contaminação por fungos não seria responsável por tais mortes — disse Petrovitch. — Lembrem-se, havia fungos flutuando na Mirtodo o tempo, e ninguém morreu por causa disso. — Ele olhou para a tela do computador. — Este genoma nos diz que estamos lidando com uma nova forma de vida inteiramente diferente. Concordo com Jack. Tem de ter sido fabricada em laboratório.

—Então, trata-se de bio terrorismo — disse Woody Ellis. — Alguém sabotou a nossa estação. Devem tê-la enviado em uma das cargas úteis.

Liz Gianni balançou a cabeça vigorosamente. Agressiva e intensa, era uma presença forte em qualquer reunião e agora falava com absoluta segurança.

—Toda carga útil passa por revistas de segurança. Há relatórios de riscos e análises de três fases dos dispositivos de conten­ção. Acreditem, teríamos vetado qualquer coisa assim perigosa.

—Supondo que soubessem que era perigoso — disse Ellis.

—Claro que saberíamos!

—E se houve uma brecha na segurança? — disse Jack. — A maior parte das experiências vem diretamente dos pesquisadores principais, dos próprios cientistas. Não sabemos como é a segu­rança deles. Não sabemos se têm um terrorista trabalhando em seu laboratório. Se mudassem uma cultura de bactérias no últi­mo minuto, quem saberia, necessariamente?

Pela primeira vez, Liz pareceu insegura.

— E... é improvável.

—Mas pode acontecer.

Embora ela não admitisse a possibilidade, seus olhos pare­ciam aflitos.

—Vamos inquirir cada pesquisador principal — disse ela. — Cada cientista que tenha enviado uma experiência. Se tiveram uma falha de segurança... merda, eu vou descobrir.

Provavelmente descobrirá, pensou Jack. Como os outros homens naquela sala, ele também tinha um pouco de medo de Liz Gianni.

—Tem uma pergunta que ainda não nos fizemos — disse Gordon Obie, que falava pela primeira vez. Como sempre, se fi­zera de Esfinge, ouvindo sem comentários, processando a informação silenciosamente. — A pergunta é por quê? Por que alguém sabotaria a estação? Alguém tem algo contra nós? Um fanático adversário da tecnologia?

—O equivalente biológico do Unabomber — disse Todd Cutler.

—Então, por que não liberar o organismo no JSC e matar toda a nossa infra-estrutura? Seria mais fácil e muito mais lógico.

—A lógica não se aplica quando se trata de fanáticos — destacou Cutler.

—Você pode aplicar lógica a qualquer um, incluindo os fanáticos — respondeu Gordon. — Desde que você saiba em que bases operam. E é isso o que me preocupa. Por isso me pergunto se realmente estamos lidando com sabotagem.

—O que mais seria, senão sabotagem? — perguntou Jack.

—Há outra possibilidade. E pode ser tão assustadora quanto a anterior — disse Gordon, seu olhar preocupado virando-se para Jack. — Um erro.

Com medo do que estava prestes a enfrentar, o Dr. Isaac Roman avançava às carreiras pelo corredor, o alarme do pager soando à sua cintura. Silenciou o aparelho e abriu a porta que levava à suíte de isolamento no Nível 4. Não entrou no quarto do paciente, mas ficou em pé e a salvo do lado de fora enquanto olhava horrorizado para o que acontecia do outro lado da janela de observação.

Havia sangue espirrado nas paredes e acumulado em poças pelo chão onde o Dr. Nathan Helsinger estava deitado, debatendo-se. Duas enfermeiras e um médico usando trajes espaciais tentavam evitar que ele se ferisse, mas seus espasmos eram tão violentos e poderosos que não conseguiam contê-lo. Uma perna escapou e uma enfermeira foi projetada para trás, escorregando no chão de concreto manchado de sangue.

Roman apertou o botão do interfone.

—Seu traje! Há alguma brecha?

Quando a enfermeira se levantou lentamente, ele pôde ver a expressão de terror no rosto dela. A mulher olhou para as luvas, para as mangas, então para a junção da mangueira de ar de seu traje.

—Não — disse ela em meio a um suspiro de alívio. — Nenhuma brecha.

Havia sangue manchando a janela. Roman recuou quando as gotículas brilhantes escorreram pelo vidro. Helsinger voltou a bater a cabeça no chão, sua coluna relaxando e, então, distendendo-se outra vez. Opistótonos. Roman só vira aquela postura bi­zarra uma vez, em uma vítima de envenenamento por estricnina, o corpo se curvando para trás como um arco retesado. Helsinger teve outro espasmo, e seu crânio se chocou contra o concreto. O sangue manchou as viseiras das duas enfermeiras.

—Afastem-se! — ordenou Roman pelo interfone.

—Ele está se ferindo! — disse o médico.

—Não quero mais ninguém exposto.

—Se pudéssemos controlar estes espasmos...

—Nada podem fazer para salvá-lo. Quero quer todos se afastem agora, antes de se ferirem.

Relutantes, as duas enfermeiras se afastaram. Após uma pau­sa, o médico também recuou. Ficaram imóveis e em silêncio enquanto a cena de horror se desenrolava aos seus pés.

Novas convulsões fizeram Helsinger voltar a bater com a cabeça no chão. O couro cabeludo se abriu, como tecido rasgando na costura. A poça de sangue tornou-se um lago.

Oh, meu Deus, olhe para os olhos dele! — gritou uma das enfermeiras.

Os olhos estavam saltados para fora, como duas bolas de gude gigantes tentando escapar das órbitas. Proptose traumática, pensou Roman. Os olhos estavam sendo empurrados por uma pressão in­tracraniana catastrófica, as pálpebras inteiramente arregaçadas.

As convulsões prosseguiram, implacáveis, a cabeça batendo no chão. Lascas de osso voavam e se chocavam contra o vidro. Era como se ele estivesse tentando romper o próprio crânio para liberar o que quer que estivesse preso ali dentro.

Outro estalo. Mais sangue e ossos.

Devia estar morto. Por que ainda tinha convulsões?

Mas até mesmo as galinhas continuam a estremecer e a se debater quando decapitadas, e os estertores de Helsinger ainda não haviam terminado. Sua cabeça ergueu-se do chão, a espinha curvando-se para a frente como uma mola sendo pressionada até o limite antes de ser liberada. Seu pescoço foi projetado para trás. Ouviu-se um estalo, e o crânio se abriu como um ovo. Lascas de ossos voaram. Um aglomerado de matéria cinzenta chocou-se contra o vidro.

Roman recuou, atônito, a náusea subindo à sua garganta. Ele baixou a cabeça, lutando para manter o controle. Lutando contra a escuridão que ameaçava tomar conta de sua visão.

Suado, trêmulo, conseguiu erguer a cabeça e olhar outra vez pela janela.

Nathan Helsinger finalmente ficara imóvel. O que restava de sua cabeça repousava sobre um lago de sangue. Havia tanto san­gue que, por um instante, Roman não conseguiu ver nada além daquela poça escarlate que se alargava. Então, seu olhar se voltou para o rosto do morto. Para a massa azul-esverdeada que palpita­va grudada à sua testa. Cistos.

Quimera.

 

14 de agosto

—Nicolai? Nicolai, por favor responda!

—Meu ouvido... Está em meu ouvido!

—Dói? Seu ouvido dói? Olhe para mim!

—Está entrando! Tire isso! Tire...

Jared Profitt, o consultor de ciências do Conselho de Segurança da Casa Branca, desligou o gravador cassete e olhou para os homens e mulheres sentados ao redor da mesa. Todos tinham expressões horrorizadas estampadas na face.

—O que aconteceu com Nicola! Rudenko foi mais que um acidente de descompressão — disse ele. — Por isso fizemos o que fizemos. Por isso, peço que todos mantenham as ações. Há muito em jogo. Até sabermos mais sobre esse organismo, como ele se reproduz, como infecta, não podemos deixar os astronautas vol­tarem para casa.

A reação foi um silêncio atônito. Até mesmo o administrador da NASA, Leroy Cornell, que começara a reunião com um pro­testo veemente contra a intervenção em sua agência, ficou senta­do, calado, sem palavras.

Foi o presidente quem fez a primeira pergunta.

—O que nós sabemos sobre este organismo?

—O Dr. Isaac Roman, do USAMRIIB, pode responder me­lhor que eu -— disse Profitt, acenando para o médico, Roman, que não estava sentado à mesa, mas na periferia, onde permaneceu sem ser notado pelos outros na sala. Ele deu um passo adian­te, um homem alto e grisalho com olhos exaustos.

—Infelizmente, as notícias não são boas — disse ele. — Injetamos a Quimera em diversas espécies de mamíferos, incluindo cães e macacos-aranha. Em 96 horas, iodos tinham morrido. Um taxa de mortalidade de 100 por cento.

—E não há tratamento? Nada que tenha funcionado? perguntou o secretário de Defesa.

—Nada. O que é bastante assustador. Mas há notícias piores.

A sala ficou em silêncio, e o medo despontou no rosto de todos. O que podia ser pior do que aquilo?

—Repetimos a análise de DNA de ovos de gerações mais recentes deste organismo, coletados de macacos mortos. A Quime­ra adquiriu um novo aglomerado de genes, especificamente do Ateles geoffroyi.O macaco-aranha.

O presidente empalideceu. Ele olhou para Profitt,

—Isso quer dizer o que estou pensando?

—É devastador — disse Profitt. — Toda vez que essa forma de vida invade um novo hospedeiro, toda vez que produz uma nova geração, ela parece adquirir um novo DNA. Ela tem a habi­lidade de estar sempre diversos passos à nossa frente, adquirindo novos genes, novas capacidades que não tinha antes.

Como diabos consegue fazê-lo? — perguntou o general Moray, do Estado-Maior. — Um organismo que adquire um novo gene? Que se refaz? Isso me parece impossível.

Roman disse:

—Não é impossível, senhor. Na verdade, há um processo semelhante que ocorre na natureza. Frequentemente, as bactérias compartilham genes umas com as outras, usando os vírus como intermediários. É assim que adquirem resistência a antibióticos tão rapidamente. Elas ampliam seus genes para terem mais resis­tência, acrescentando novo DNA aos seus cromossomos. Como tudo o mais na natureza, usam as armas que têm para sobreviver. Para perpetuar a sua espécie. E é isso que esse organismo está fa­zendo. — Ele foi até a cabeceira da mesa, onde havia um cartaz com uma fotografia tirada por um microscópio eletrônico. — Es­tes pequenos grânulos nesta célula são aglomerados de vírus as­sistentes. Mensageiros que entram na célula do hospedeiro, vas­culham seu DNA e trazem de volta pedaços de material genético para a Quimera. Acrescentando novos genes, novas armas para seu arsenal. — Roman olhou para o presidente. — Esse organis­mo está equipado para sobreviver em qualquer condição am­biental. Tudo o que precisa é vasculhar o DNA da fauna local.

O presidente pareceu adoentado.

—Então, ainda está mudando. Ainda está evoluindo.

Ouviram-se murmúrios de desalento ao redor da mesa. Olhares atemorizados, cadeiras rangendo.

—E quanto àquele médico que foi infectado? — perguntou uma mulher do Pentágono. — Aquele que o USAMRIID manti­nha em isolamento de Nível 4? Ainda está vivo?

Roman fez uma pausa, a dor espelhada nos olhos.

—O Dr. Helsinger morreu na noite passada. Testemunhei o seu fim e foi... uma morte horrível. Ele começou a se contorcer de modo tão terrível que não ousamos controlá-lo, com medo do traje espacial de alguém se romper e expor o seu ocupante. Nun­ca vi convulsões assim. Era como se cada neurônio de seu cérebro tivesse entrado em curto. Ele quebrou o anteparo da cama. Ar­rancou-o da moldura com uma pancada. Rolou para fora do col­chão e começou... a bater com a cabeça no chão com tanta força que pudemos... — Ele engoliu em seco. — Pudemos ouvir o seu crânio partir. A essa altura, havia sangue por toda parte. Ele con­tinuou batendo a cabeça no chão, como se estivesse tentando abri-la para liberar a pressão interna. O trauma só piorou as coi­sas, porque o cérebro começou a sangrar. No fim, a pressão intra­craniana era tão grande que expeliu seus olhos das órbitas. Como um personagem de desenho animado. Como um animal que a gente vê atropelado na estrada. — Ele inspirou profundamente. — Esse... — disse ele baixinho — foi o seu fim.

—Agora vocês compreendem a possível epidemia que temos pela frente — disse Profitt. — Por isso, não podemos nos dar ao luxo de sermos fracos, descuidados ou sentimentais.

Houve outro longo silêncio. Todos se voltaram para o presiden­te. Todos esperavam — ansiavam — por uma decisão inequívoca.

Em vez disso, o presidente guiou sua cadeira em direção à janela e olhou para fora.

—Certa vez, desejei ser astronauta — disse ele com tristeza.

Todos nós desejamos isso algum dia, pensou Profitt. Qual criança neste país já não sonhou em subir ao espaço a bordo de um foguete?

—Estive lá quando lançaram John Glenn no ônibus espacial — disse o presidente. — E chorei. Como todo mundo. Droga, eu chorei como um bebê. Porque estava orgulhoso dele. E deste país. Orgulhoso apenas por ser membro da espécie humana... — Ele fez uma pausa, inspirou profundamente e passou a mão sobre os olhos. — Como posso condenar essa gente à morte?

Profitt e Roman trocaram olhares de desagrado.

—Não temos escolha, senhor — disse Profitt. — São cinco vidas contra as de sabe-se lá quanta gente aqui na Terra.

—Eles são heróis. Heróis de verdade. E vamos deixá-los morrer lá em cima.

—As probabilidades indicam que não poderíamos salvá-los de qualquer modo, senhor presidente — disse Roman. — Todos provavelmente estão infectados. Ou logo estarão.

—Então alguns deles podem não estar infectados?

—Não sabemos. Rudenko com certeza está. Acreditamos que foi infectado em seu traje de EVA. Se bem se lembra, o astronauta Hirai foi encontrado tendo convulsões na câmara de equi­pamentos de EVA há dez dias. Isso pode explicar como o traje foi contaminado.

—Por que os outros ainda não estão doentes? Por que apenas Rudenko?

—Nossos estudos indicam que esse organismo precisa de tempo de incubação antes de atingir o estágio infeccioso. Acredi­tamos que é mais contagioso à hora da morte do hospedeiro, ou logo depois, quando sai de seu corpo. Mas não temos certeza. Não podemos nos dar ao luxo de errar. Devemos assumir que são todos portadores.

—Então, vamos mantê-los em isolamento de Nível 4 até sabermos. Mas ao menos vamos trazê-los para casa.

—Senhor, é aí que entra o risco — disse Profitt. — No trazê- los para casa. O CRV não é como um ônibus espacial, que você pode guiar até um campo de pouso específico. Eles virão para casa em um veículo bem menos controlável, essencialmente uma cápsula dotada de paraquedas. E se algo der errado? E se o CRV explodir na atmosfera ou se espatifar na aterrissagem? Este orga­nismo seria liberado no ar. O vento poderia levá-lo para qualquer parte! À essa altura, haveria tanto DNA humano no seu genoma que não poderíamos combatê-lo. Seria muito como nós mesmos. Qualquer droga que usássemos contra ele mataria os humanos também. — Profitt fez uma pausa para que suas palavras fizes­sem efeito. — Não podemos deixar que as emoções afetem a nos­sa decisão. Não com tanto em jogo.

—Sr. presidente — interrompeu Leroy Cornell —, com todo o respeito, devo destacar que esta seria uma decisão politicamente de­sastrosa. O público não deixará cinco heróis morrerem no espaço.

—A política deveria ser a nossa última preocupação agora! — disse Profitt. — Nossa principal prioridade é a saúde pública!

—Então, por que o segredo? Por que tiraram a NASA da jogada? Só nos mostraram partes do genoma do organismo. Nosso pessoal de ciências naturais está pronto, querendo colaborar com a sua experiência. Queremos encontrar uma cura tanto quanto... ou até mais... que vocês. Se o USAMRIID compartilhasse suas informações conosco, poderíamos trabalhar juntos.

—Nossa preocupação é com a segurança — disse o general Moray. — Um país hostil poderia transformar isto em uma arma biológica devastadora. Divulgar o código genético da Quimera é como entregar o projeto de tal arma.

—Quer dizer que não confiaria esta informação à NASA?

O general Moray encarou Cornell.

— Infelizmente, a nova filosofia da NASA de compartilhar tecnologia com cada pequeno país sob o sol não faz de sua agên­cia um lugar seguro.

Cornell ficou roxo de raiva, mas não disse nada.

Profitt olhou para o presidente.

—Senhor, realmente é uma tragédia o fato de cinco astronautas terem de ser abandonados lá em cima para morrer. Mas temos de olhar para além disso, para a possibilidade de uma tra­gédia muito maior. Uma epidemia mundial, causada por um or­ganismo que ainda estamos começando a entender. O USAMRIID está trabalhando dia e noite para aprender como ele funciona. Até lá, aconselho vivamente que mantenham tudo como está. A NASA não está equipada para lidar com um desas­tre biológico. Eles têm apenas um encarregado de proteção pla­netária. Um. A Equipe de Resposta Biológica Rápida está prepa­rada exatamente para este tipo de crise. Quanto às operações da NASA, deixem-nas sob controle do Comando Espacial dos EUA, apoiado pelos 14 da Força Aérea. A NASA tem muitos laços pes­soais e emocionais com os astronautas. Precisamos agir com fir­meza. Precisamos de disciplina absoluta.

Profitt olhou lentamente para os homens e mulheres senta­dos à longa mesa. Na verdade, respeitava poucas daquelas pes­soas. Algumas só estavam interessadas em prestígio e poder. Ou­tras só estavam ali devido às suas ligações políticas. Ainda outras eram muito facilmente influenciadas pela opinião pública. Pou­cos tinham motivos tão elementares quanto os seus.

Poucos compartilhavam os seus pesadelos ou despertavam encharcados de suor durante a noite, abalados pela terrível visão daquilo que teriam de enfrentar.

—Então, está dizendo que os astronautas nunca mais pode­rão voltar para casa — disse Cornell.

Profitt olhou para o rosto pálido do administrador da NASA e sentiu autêntica simpatia por ele.

—Quando encontrarmos uma cura, quando soubermos como matar este organismo, então poderemos falar em trazer o seu pessoal de volta.

—Se ainda estiverem vivos — murmurou o presidente.

Profitt e Roman se entreolharam, mas nenhum deles respondeu. Já haviam compreendido o óbvio. Não encontrariam uma cura a tempo. Os astronautas não voltariam vivos para casa.

Jared Profitt caminhava de terno e gravata naquele dia escaldan­te, mas não ligava para o calor. Outros podiam reclamar do calor de verão em DC. Já ele não se incomodava com as altas tempera­turas. Por ser tão sensível ao frio, era o inverno que ele temia. Em dias frios, seus lábios ficavam azulados e ele tremia até mesmo sob várias camadas de cachecóis e suéteres. Mesmo durante o ve­rão, ele mantinha um suéter no escritório para combater o frio do ar-condicionado. Naquele dia, a temperatura chegava a 32 graus e o suor brilhava em todos os rostos com os quais cruzava na rua. Mas ele não tirava o terno e nem afrouxava a gravata.

A reunião o deixara com muito frio, tanto no corpo quanto na alma.

Trazia o almoço em um saco de papel marrom, o mesmo almoço que preparava toda manhã antes de ir para o trabalho. O trajeto que seguia era sempre o mesmo, oeste em direção ao Potomac, o Espelho D'água à sua esquerda. Ele gostava de rotina, de familiaridades. Ultimamente, havia poucas coisas em sua vida que oferecessem segurança e, ao envelhecer, descobriu-se aderin­do a certos rituais, muito semelhante ao modo como um monge em uma ordem religiosa adere ao ritmo diário de trabalho, rezas e meditação. Em muitos aspectos ele se assemelhava a esses anti­gos ascetas, um homem que só comia para alimentar o corpo e vestia ternos apenas porque esperavam isso dele. Um homem para quem a riqueza nada significava.

O nome Profitt— semelhante à palavra "lucro", em inglês — não podia ser mais inadequado.

Diminuiu a marcha de sua caminhada ao passar pela colina relvada junto ao Memorial da Guerra do Vietnã e olhou para a fila solene de visitantes que passava diante do muro onde estavam gra­vados os nomes dos mortos. Sabia o que todos estavam pensando ao confrontarem aqueles painéis de granito negro e considerarem os horrores da guerra: Tantos nomes. Tantos mortos.

E pensou: Vocês não fazem idéia.

Encontrou um banco vazio à sombra e sentou-se para comer. Do saco marrom tirou uma maçã, uma fatia de queijo cheddar e uma garrafa de água. Não era Evian e nem Perrier, mas água da bica. Comeu lentamente, observando os turistas que faziam o cir­cuito do memorial. Então, nós honramos os nossos heróis de guer­ra, pensou. A sociedade erige estátuas, grava placas de mármore, ergue bandeiras. Estremece diante do número de vidas perdidas de ambos os lados no matadouro das guerras. Dois milhões de soldados e civis mortos no Vietnã. Cinquenta milhões mortos na Segunda Guerra Mundial. Vinte e um milhões na Primeira Guer­ra Mundial. Os números eram consternadores. As pessoas de­viam se perguntar: teria o homem um inimigo mais letal do que ele mesmo?

A resposta era "sim".

Embora os seres humanos não possam vê-lo, o inimigo está à sua volta. Dentro deles. No ar que respiram, na comida que inge­rem. Através da história da humanidade, aquilo foi a sua nêmesis, algo que sobreviveria a eles muito tempo depois de terem desapa­recido da face da Terra. O inimigo era o mundo dos micróbios que, ao longo dos séculos, matou mais gente do que todas as guerras combinadas.

De 542 a 767 d.C., 40 milhões de pessoas morreram durante a pandemia Justiniana.

No século XII, 25 milhões de pessoas morreram com a volta da Peste Negra.

Entre 1918 e 1919, 30 milhões morreram de gripe.

E, em 1997, Amy Sorensen Profitt, 43 anos, morreu de uma pneumonia provocada por pneumococos.

Ele terminou de comer a maçã, guardou o talo no saco marrom e enrolou tudo em um volume bem apertado. Embora o al­moço tivesse sido frugal, sentia-se satisfeito, e ficou algum tempo sentado no banco, terminando de beber sua água.

Uma turista passou perto dali, uma mulher de cabelo castanho-claro. Quando ela se voltou e o sol iluminou seu rosto, achou-a parecida com Amy. A mulher sentiu estar sendo obser­vada e voltou-se para ele. Olharam-se um instante, ela desconfia­da, ele desculpando-se em silêncio. Então a mulher se foi, e Pro­fitt decidiu que ela não se parecia com sua falecida esposa. Ninguém se parecia. Ninguém poderia se parecer.

Levantou-se, descartou os restos em uma lixeira e começou a voltar pelo caminho que viera. Passou pelo muro. Pelos vetera­nos uniformizados, já grisalhos e desgrenhados, fazendo a sua vigília. Honrando a memória dos mortos.

Mas até mesmo as memórias esvaecem,pensou. A imagem de seu sorriso do outro lado da mesa da cozinha, o eco de sua risada — tudo isso desaparecia lentamente à medida que o tempo passa­va. Apenas as memórias dolorosas permaneciam. Um quarto de hotel em São Francisco. Um telefonema no meio da noite. Imagens frenéticas de aeroportos, táxis e cabines telefônicas, enquanto ele atravessava o país para chegar a tempo ao Hospital Bethesda.

Mas o estreptococo necrotizante tinha a sua própria agenda, seu próprio horário para matar. Exatamente como a Quimera.

Inspirou uma golfada de ar e perguntou-se quantos vírus, quantas bactérias, quantos fungos haviam acabado de entrar em seus pulmões. E qual deles o mataria.

 

15 de agosto

-Eles que se fodam — disse Luther.

A comunicação ar-terra estava desligada, e sua conversa não estava sendo monitorada pelo Controle da Missão. —Vamos voltar ao CRV, acionar os botões e ir embora. Eles não podem nos obrigar a dar meia-volta.

Uma vez que deixassem a estação, não poderiam voltar. O CRV era essencialmente um planador com paraquedas. Depois da separação da ISS, podia dar um máximo de quarto voltas ao redor da Terra antes de ser forçado a sair de órbita e pousar.

—Fomos aconselhados a esperar — disse Griggs. — E é isso o que faremos.

—Seguir ordens idiotas? Nicolai vai morrer caso não o levemos para casa!

Griggs olhou para Emma.

—Sua opinião, Watson?

Nas última 24 horas, Emma estivera junto ao paciente, monitorando as condições de Nicolai. Todos podiam ver que ele estava em condições críticas. Amarrado à maca, tinha espasmos e tre­mores tão violentos que Emma teve medo de que fraturasse al­gum osso dos braços ou das pernas. Parecia um lutador de boxe que tivesse apanhado impiedosamente no ringue. Enfisemas sub­cutâneos manchavam o tecido macio de seu rosto, inchando suas pálpebras a ponto de elas quase se fecharem. Através da estreita brecha, dava para ver que o branco de seus olhos estava tomado de um vermelho-brilhante, demoníaco.

Ela não sabia o quanto Nicolai podia ouvir e entender; portanto, não ousava dizer em voz alta o que estava pensando. Fez sinal para que os outros tripulantes saíssem do módulo de serviço russo.

Reuniram-se no modulo habitacional, onde Nicolai não po­dia ouvi-los, e onde podiam remover as máscaras e os óculos de proteção com segurança.

Houston precisa autorizar o nosso resgate o quanto antes — disse ela. — De outro modo, vamos perdê-lo.

—Eles estão cientes da situação — disse Griggs. — Eles não podem autorizar uma evacuação sem ordens da Casa Branca.

—Então vamos ficar aqui em cima vendo um por um adoe­cer? — disse Luther. — E se apenas entrássemos do CRV e fôssemos embora? O que fariam? Atirariam em nós?

Diana disse baixinho.

—Podem fazê-lo.

A verdade do que ela acabara de dizer fez com que todos se calassem. Todo astronauta que já embarcou em um ônibus espa­cial e aguardou a contagem regressiva sabia que, sentada em um bunkerno KSC, havia uma equipe de oficiais da Força Aérea cujo único trabalho era explodir o ônibus espacial, incinerando a sua tripulação. Caso o sistema direcional falhasse durante o lançamen­to, caso o ônibus espacial desviasse perigosamente em direção a uma área populosa, era dever desses encarregados da segurança apertarem os botões de destruição. Eles conheciam cada membro da tripulação do ônibus espacial. Provavelmente tinham visto fo­tografias das famílias dos astronautas. Sabiam exatamente quem estariam matando. Era uma responsabilidade terrível, mas nin­guém duvidava de que aqueles oficiais cumpririam a sua missão.

Do mesmo modo que eles quase certamente destruiriam o CRV caso lhes fosse ordenado. Diante do espectro de uma epidemia nova e letal, a vida de cinco astronautas pareceria algo trivial.

—Aposto que nos deixariam pousar em segurança — disse Luther. — Por que não o fariam? Quatro de nós ainda estão sau­dáveis. Nós não pegamos nada.

—Mas já fomos expostos — disse Diana. — Respiramos o mesmo ar, compartilhamos os mesmos ambientes. Você e Nicolai dormiram juntos naquela câmara, Luther.

—Sinto-me perfeitamente bem.

—Eu também, assim como Griggs e Watson. Mas, caso seja uma infecção, já podemos estar na fase de incubação.

—Por isso devemos seguir ordens — disse Griggs. — Ficaremos exatamente onde estamos.

Luther voltou-se para Emma.

—Você concorda com esta baboseira de mártir?

—Não — disse ela. — Não concordo.

Griggs olhou surpreso para ela.

Watson?

—Não estou pensando em mim — disse Emma. — Estou pensando em meu paciente. Nicolai não pode falar; portanto, te­nho de falar por ele. Eu o quero em um hospital, Griggs.

—Você ouviu o que Houston disse.

—O que ouvi foi muita confusão. Ordens de evacuação sen­do dadas, depois canceladas. Primeiro, nos dizem ser o vírus Marburg. Depois, dizem que não é um vírus, mas um novo orga­nismo fabricado por bio terroristas. Não sei o que diabos está acontecendo lá embaixo. Tudo o que sei é que meu paciente... — Emma baixou abruptamente o tom de voz. —... está morren­do. Minha responsabilidade primeira é mantê-lo vivo.

—E a minha responsabilidade é agir como comandante desta estação — disse Griggs. — Tenho de acreditar que Houston está fazendo o melhor que pode. Não nos deixariam correr perigo a não ser que a situação fosse realmente grave.

Emma não tinha como discordar. O Controle da Missão era administrado por gente que ela conhecia, pessoas em quem con­fiava. E Jack está lá, pensou. Não havia um ser humano em que ela confiasse mais.

—Parece que estão enviando algo lá de baixo — disse Diana, olhando para o computador. — É para Watson.

Emma flutuou através do modulo para ler a mensagem que brilhava na tela. Era da Superintendência de Ciências Naturais da NASA.

Dra. Watson,

Achamos que você devia saber exatamente com o que está lidando — com o que todos estamos lidando. Esta é a análise do DNA do organismo que infectou Kenichi Hirai.

Emma abriu o arquivo anexado.

Demorou um instante para que ela processasse mentalmente a sequência do nucleotídeo que passava pela tela. Alguns minutos mais para realmente acreditar nas conclusões.

Genes de três espécies diferentes em um único cromossomo. Rã-leopardo. Rato. E humano.

—O que é esse organismo? — perguntou Diana.

Emma disse baixinho:

—Uma nova forma de vida.

Era um monstro de Frankenstein. Uma abominação da natureza. Subitamente ela se concentrou na palavra "rato" e pensou: os ratos. Eles foram os primeiros a ficar doentes. Durante uma se­mana e meia continuaram a morrer. Na última vez que ela verifi­cara a gaiola, apenas um rato, uma fêmea, ainda estava viva.

Ela deixou o modulo habitacional e dirigiu-se para a metade sem energia da estação.

O laboratório dos EUA estava imerso em penumbras. Ela flutuou através da semi-escuridão em direção às gavetas onde ficavam as gaiolas. Teriam sido os ratos os portadores origi­nais desse organismo, os recipientes nos quais a Quimera fora trazida para bordo da ISS? Ou eram apenas outras vítimas acidentais, infectadas pela de exposição a outra coisa dentro da estação?

O último rato ainda estaria vivo?

Ela abriu a gaveta e olhou dentro da gaiola para seu último residente.

Decepcionou-se. O rato estava morto.

Ela passara a pensar naquela fêmea com uma orelha mordida como uma lutadora, uma aguerrida sobrevivente que, por pura teimosia, sobrevivera aos seus colegas de gaiola. Agora, Emma sentia uma inesperada tristeza ao olhar para o corpo inerte flutu­ando na outra extremidade da gaiola. Seu abdome já parecia in­chado. O corpo teria de ser removido e descartado imediatamen­te com o lixo contaminado.

Conectou a gaiola à caixa de luvas, inseriu as mãos nas luvas e as estendeu para pegar o rato. Contudo, no instante em que seus dedos se fecharam, o corpo subitamente voltou à vida. Emma emitiu um grito surpreso e soltou-o.

O rato se voltou e olhou feio para ela, os bigodes irrequietos de irritação.

Emma emitiu uma sonora gargalhada.

—Então, você não está morta, afinal de contas — murmurou.

Watson!

Ela se voltou para o interfone que acabara de gritar seu nome.

—Estou no laboratório.

—Venha para cá! No RSM. Nicolai está tendo convulsões!

Emma saiu voando do laboratório, ricocheteando nas pare­des em meio à escuridão enquanto avançava em direção à extremidade russa. A primeira coisa que viu ao chegar ao RSM foi o rosto dos outros tripulantes, o horror evidente que expressavam mesmo através dos óculos de segurança. Então todos se afasta­ram e ela olhou para Nicolai.

Seu braço esquerdo se estendia em espasmos tão poderosos que faziam tremer toda a maca de contenção.

As convulsões passaram para o lado esquerdo de seu corpo, e a perna também começou a ser vítima de espasmos. Agora eram seus quadris que se moviam abruptamente, estremecendo a maca à medida que as convulsões continuavam a marcha inexorável através de seu corpo. As convulsões se intensificaram, as amarras ferindo-lhe os pulsos. Emma ouviu um estalo macabro quando os ossos de seu antebraço esquerdo se romperam. A amarra do pulso direito se partiu, e o braço começou a se mover descontro­ladamente, as costas da mão golpeando a borda da mesa, esma­gando ossos e carne.

—Contenham-no! Vou enchê-lo de Valium! — gritou Emma, remexendo freneticamente o kit médico.

Griggs e Luther agarraram os braços de Nicolai, mas nem mesmo Luther era forte o bastante para conter o membro livre. O braço direito de Nicolai moveu-se como um chicote e empurrou Luther para o lado. Luther caiu e seu pé tocou a face de Diana, deslocando-lhe os óculos de segurança.

A cabeça de Nicolai subitamente se chocou contra a mesa. Ele ofegou com a respiração gorgolejante, seu peito encheu-se de ar e a tosse explodiu de sua garganta.

O catarro atingiu o rosto de Diana. Ela emitiu um grito enojado e soltou Nicolai, afastando-se enquanto esfregava o olho exposto.

Um glóbulo de muco azul-esverdeado passou flutuando per­to de Emma. No interior daquela massa gelatinosa havia um núcleo parecido com uma pérola. Apenas quando passou diante da luminária do sistema de iluminação Emma se deu conta do que estava vendo. Quando um ovo de galinha é erguido diante da chama de uma vela, é possível ver-lhe o conteúdo através da cas­ca. Agora, a luminária estava funcionando como a vela, seu bri­lho penetrando a membrana opaca do núcleo.

Lá dentro, algo se movia. Algo estava vivo.

O monitor cardíaco disparou. Emma voltou-se e viu que Nicolai havia parado de respirar. Uma linha plana atravessava o monitor.

 

16 de agosto

Jack colocou os fones de ouvido. Estava a sós na sala dos fundos do Controle da Missão, e aquela conversa supostamente seria confidencial, mas ele sabia que tudo o que ele e Emma dissessem não ficaria apenas entre eles. Ele suspeitava que todas as comuni­cações com a ISS estavam sendo monitoradas pela Força Aérea e pelo Comando Espacial dos EUA.

Capcom, aqui é o Cirurgião. Estou pronto para a minha conferência particular de família.

—Entendido, Cirurgião — disse o Capcom. — Controle de Terra, estabeleça a conexão ar-terra. — Houve uma pausa. — Ci­rurgião, proceda a PFC.

O coração de Jack batia forte. Ele inspirou profundamente e disse:

—Emma, sou eu.

—Ele talvez tivesse sobrevivido se o tivéssemos levado para casa — disse ela. — Talvez tivesse tido uma chance.

—Não fomos nós que cancelamos o resgate! A NASA foi desautorizada a fazê-lo. Estamos lutando para trazê-los para casa o quanto antes. Vocês têm de aguentar.

—Não vai dar tempo, Jack — disse ela baixinho, pragmática. As palavras dela fizeram gelar a espinha de Jack. — Diana está infectada.

—Tem certeza?

—Acabei de medir o seu nível de amilase. Está subindo. Nós a estamos observando agora. Esperando pelos primeiros sintomas. Aquele negócio se espalhou por todo o módulo. Nós limpa­mos tudo, mas não estamos certos se alguém mais foi exposto. — Ela fez uma pausa, e ele a ouviu inspirar, trêmula. — Sabe aquelas coisas que você viu dentro de Andy e Jill? As coisas que achou que eram cistos? Seccionei uma sob o microscópio. Acabei de enviar as imagens para o pessoal de Ciências Naturais. Não são cistos, Jack. E não são esporos.

—E o que são?

—São ovos. Há algo dentro deles. Algo crescendo.

—Crescendo? Está dizendo que são multicelulares?

—Sim. É exatamente isso que estou dizendo.

Ele ficou atônito. Achavam estar lidando com um micróbio, nada maior que uma bactéria unicelular. Os inimigos mais mor­tais da humanidade sempre foram micróbios: bactérias, vírus e protozoários, pequenos demais para serem detectados pelo olho humano. Se a Quimera era multicelular, então era muito mais avançada que uma simples bactéria.

—A que eu vi ainda não estava formada — disse ela. — Era mais como um... aglomerado de células. Mas com canais vascula­res. E movimentos contráteis. Como se toda a coisa pulsasse, como uma cultura de células miocárdicas.

—Talvez fosse mesmo uma cultura. Um grupo de células aglomeradas.

—Não, acho que era um único organismo. E ainda era jo­vem, ainda estava se desenvolvendo.

—Para se tornar o quê?

—O USAMRIID sabe — disse ela. — Essas coisas estavam crescendo dentro do corpo de Kenichi Hirai. Digerindo os seus órgãos. Quando seu corpo se desintegrou, devem ter se espalha­do por todo o veículo orbital.

Que os militares imediatamente puseram em quarentena, pen­sou Jack, lembrando-se dos helicópteros e dos homens com trajes espaciais.

—Também estão se desenvolvendo no corpo de Nicolai.

—Ejete o corpo, Emma! Não perca tempo.

—Estamos fazendo isso agora. Luther está se preparando para lançar o corpo através da escotilha. Esperemos que o vácuo do espaço mate esta coisa. E um evento histórico, jack. O primeiro funeral humano no espaço.

Ela deu uma risada estranha que rapidamente silenciou.

—Ouça — disse ele. — Eu vou trazê-la de volta para casa. Mes­mo que tenha de arranjar um foguete e subir até aí para buscá-la.

—Eles não vão deixar que voltemos para casa. Sei disso agora.

Ele jamais a ouvira soar tão derrotada, o que o deixou furio­so. Desesperado.

—Não me venha com choradeiras, Emma!

— Só estou sendo realista. Eu vi o inimigo, Jack. A Quimera é uma forma de vida complexa e multicelular. Ela se move. Se re­produz. Usa o nosso DNA, os nossos genes, contra nós. Se o orga­nismo é fruto de bioengenharia, algum terrorista acabou de criar a arma perfeita.

—Então ele deve ter projetado uma defesa. Ninguém usa uma nova arma sem saber como se defender dela.

—Um fanático, sim. Um terrorista cujo único interesse é o de matar pessoas. Muita gente. Esse organismo pode fazê-lo. Não apenas mata, mas se reproduz. Se espalha, — Ela fez uma pausa, a exaustão tomou conta de sua voz, — Por causa disso, obvia­mente não voltaremos para casa.

 

Jack tirou os fones de ouvido e baixou a cabeça entre as mãos. Ficou sentado sozinho na sala durante um longo tempo, o som da voz de Emma ainda vívido em sua mente. Não sei como salvá- la, pensou. Nem mesmo sei por onde começar.

Ele não ouviu a porta se abrir. Apenas quando Liz Gianni, de Cargas Úteis, chamou foi que ele ergueu a cabeça para olhá-la.

—Temos um nome — disse ela.

Ele balançou a cabeça, confuso.

—O quê?

—Eu lhe disse que verificaria qual experiência teve de ser destruída por causa de proliferação de fungos. Acontece que era uma cultura de células. O pesquisador principal é a Dra. Helen Koenig, uma bióloga marinha da Califórnia.

—E o que sabe sobre ela?

—Desapareceu. Demitiu-se há duas semanas do laboratório SeaScience onde trabalhava. Ninguém sabe dela desde então. E, Jack, ouça só isso: acabei de falar com alguém do SeaScience. Ela me disse que investigadores federais vasculharam o laboratório de Koenig em 9 de agosto. Eles levaram todos os arquivos dela.

Jack ajeitou-se na cadeira.

—Qual era a experiência de Koenig? Que tipo de cultura de célula ela mandou lá para cima?

—Organismos marinhos unicelulares — disse Liz. — Chamam-se Archaeons.

 

-Era para ser um protocolo de três meses.

Um estudo de como os Archaeonsse mul­tiplicam em microgravidade. A cultura começou a demonstrar alguns resultados bizarros. Rápida proliferação, formação de tor­rões. Estava se multiplicando em uma taxa inacreditável.

Eles caminhavam sozinhos por um dos caminhos que cruzavam o campus do JSC, junto a uma lagoa onde uma fonte espa­lhava água no ar inerte. O dia estava desagradavelmente quente e abafado, mas sentiam-se mais seguros do lado de fora. Ali, ao menos, podiam conversar em particular.

—No espaço, as células se comportam de modo diferente — disse Jack.

Este, na verdade, era o motivo das culturas serem postas em órbita. Na Terra, os tecidos crescem ao longo da superfície plana de uma lâmina de cultura. No espaço, a ausência de gravidade permite que os tecidos cresçam em três dimensões, assumindo formas que jamais poderiam adquirir na Terra.

—Considerando quão excitantes devem ter sido tais resultados, é de se estranhar que a experiência tenha sido cancelada abruptamente há seis semanas e meia — disse Liz.

—Quem cancelou a experiência? — perguntou Jack.

—A ordem veio diretamente de Helen Koenig. Aparentemente, ela analisou amostras de Archaeonsque foram trazidas à Terra a bordo da Atlantis e descobriu que estavam contaminadas por um fungo. Mandou que a cultura a bordo da ISS fosse destruída.

—E é só?

—Sim. Mas o estranho é o modo como foi destruída. A tripulação não podia simplesmente misturá-la ao lixo contaminado e lançá-la ao espaço, que era o que normalmente fariam com um organismo não perigoso. Não. Koenig disse-lhes para porem as culturas em um cadinho e incinerá-las. Depois, então, ejetar as cinzas.

Jack parou e olhou para Liz.

—Se a Dra. Koenig é uma bioterrorista, por que destruiria a sua própria arma?

—Sei tanto quanto você.

Ele pensou a respeito um instante, tentando tirar algum sentido de tudo aquilo, mas sem conseguir uma resposta.

—Diga-me mais sobre a experiência dela — pediu Jack. — O que, exatamente, é um Archaeons

Petrovitch e eu pesquisamos a literatura científica. Archaeons são membros de um estranho tipo de organismos uni­celulares chamados extremófilosou "aqueles que amam condi­ções extremas". Foram descobertos há apenas vinte anos, vivendo e proliferando perto de chaminés vulcânicas borbulhantes no fundo dos oceanos. Também já foram encontrados enterrados no gelo polar e em rochas no fundo da crosta terrestre. Lugares onde a vida não deveria existir.

—Então são um tipo de bactéria resistente?

—Não, são um tipo de vida completamente diferente. Literalmente, seu nome significa "os antigos". De fato, são tão anti­gos que suas origens remontam ao ancestral universal de todas as formas de vida. Um tempo anterior à existência das bactérias. Os Archaeonsforam um dos primeiros habitantes de nosso planeta e provavelmente serão os últimos a sobreviver. Não importa o que aconteça... guerra nuclear, impacto de asteroides... eles estarão aqui muito tempo depois de estarmos extintos. — Ela fez uma pausa. — De certo modo, serão os últimos donos da Terra.

—São infecciosos?

—Não. São inofensivos para os humanos.

Então este não é o nosso organismo assassino.

—Mas e se havia algo mais na cultura? E se ela a substituiu por um organismo diferente antes de nos enviar a carga útil? Acho interessante o fato de Helen Koenig desaparecer justo quan­do esta crise começou a esquentar.

Jack calou-se um instante, pensando em por que Helen Koenig subitamente mandaria incinerar a sua própria experiência. Lembrou-se do que Gordon Obie dissera naquela reunião. Talvez não fosse um ato de sabotagem, mas algo igualmente assustador. Um erro.

—Há mais — disse Liz. — Algo mais a respeito desta experiên­cia que me fez desconfiar.

O quê?

Como foi financiada. Experiências de fora da NASA têm de competir para conseguirem espaço a bordo da estação. Os cientistas preenchem os seus requerimentos OLMSA explicando os possíveis usos comerciais de suas experiências. Nós os analisa­mos e os requerimentos passam por diversos comitês antes de priorizarmos quais serão aceitos. O processo é demorado. No mínimo um ano.

—Quanto tempo demorou para o requerimento do Archaeon ser aceito?

—Seis meses.

Ele franziu o cenho.

—Tão rápido?

Liz assentiu.

— Correu por fora. Não teve de competir por patrocínio da NASA, como a maioria das experiências. Foi uma transação co­mercial. Alguém pagou para mandar a experiência lá para cima.

Essa era, na verdade, uma das maneiras da NASA manter a ISS financeiramente viável: vendendo espaço de carga útil a bordo da estação para usuários comerciais.

—Então, por que uma empresa gastaria dinheiro, e estou falando em muito dinheiro mesmo, para desenvolver um tubo de ensaio de organismos essencialmente sem valor comercial? Curio­sidade científica?

Ela riu, debochada.

—Eu não creio.

—Qual empresa pagou por isso?

—A firma para a qual a Dra. Koenig trabalhava. O SeaScience, em La Jolla, Califórnia. Desenvolvem produtos marinhos comerciais.

O desespero que Jack sentira anteriormente finalmente diminuía. Agora ele tinha informação com que trabalhar. Um plano de ação. Afinal, ele poderia fazer alguma coisa.

—Preciso do endereço e do telefone do SeaScience. E o nome do empregado com quem você falou.

Liz concordou vivamente.

—Agora mesmo, Jack.

 

17 de agosto

Diana despertou de um sono agitado, a cabeça doendo, os sonhos ainda enevoando sua mente. Sonhos da Inglaterra. De sua infân­cia na Cornualha. Da bela calçada de tijolos ladeada por roseiras que levava à porta da frente. Em seu sonho, ela abria o pequeno portão e ouvia-o ranger como sempre rangia ao ser aberto, as dobradiças precisando de óleo. Começava a subir o caminho que levava ao chalé de pedra. Apenas meia dúzia de passos e estaria no alpendre, abrindo a porta. Gritando para dizer que estava em casa, finalmente em casa. Ela queria os abraços e o conforto da mãe. Mas aquela meia dúzia de passos se tornavam uma dúzia. Duas dúzias. O chalé continuava inalcançável, o caminho cada vez mais longo, até a casa encolher e ficar do tamanho de uma casa de boneca.

Diana despertou com ambos os braços estendidos, um grito de desespero na garganta.

Abriu os olhos e viu Michael Griggs observando-a. Embora seu rosto estivesse parcialmente oculto pela máscara e pelos ócu­los de proteção, ela pôde ver a sua expressão horrorizada.

Diana abriu o zíper do saco de dormir e flutuou através do módulo de serviço russo. Mesmo antes de olhar para seu reflexo no espelho, já sabia o que veria.

Uma língua flamejante de um vermelho vívido tomava o branco do seu olho esquerdo.

Emma e Luther falavam em surdina enquanto flutuavam juntos no laboratório em penumbra. A maior parte da estação ainda es­lava sem energia. Apenas o segmento russo, que tinha forneci­mento de energia independente, operava a plena carga. A parte dos EUA estava reduzida a um labirinto fantasmagórico de túneis sombrios e, na penumbra do modulo habitacional, a fonte de luz mais brilhante era a tela do computador que exibia os diagramas dos sistemas de Controle Ambiental e Suporte à Vida. Emma e Luther já estavam familiarizados com o sistema ECLS, haviam memorizado seus componentes e subsistemas durante seu trei­namento na Terra. Agora, tinham um motivo urgente para revi­sar o sistema. Havia uma contaminação a bordo, e eles não ti­nham certeza se toda a estação estava contaminada. Quando Nicolai tossiu, espalhando ovos por todo o módulo de serviço russo, a escotilha estava aberta. Em segundos, o sistema de circu­lação de ar da estação, projetado para evitar a formação de bolsões de ar estagnado, levou as gotículas para outras partes da estação. Teria o controle de sistema ambiental filtrado e capturado as partículas em suspensão, como era projetado para fazer? Ou estaria o contágio em toda parte agora, em cada módulo?

Na tela do computador havia diagramas do fluxo de ar que entrava e saía da atmosfera da estação. O oxigênio era fornecido por diversas fontes independentes. A fonte primária era o gera­dor russo Elektron, que transformava água em hidrogênio e oxigênio por meio de eletrólise. Um gerador de combustível só­lido que usava cartuchos químicos era uma das fontes reserva, assim como os tanques de armazenamento de oxigênio, que eram recarregados pelo ônibus espacial. Um sistema de tubos distribuía o oxigênio misturado ao nitrogênio por toda a esta­ção, e ventiladores mantinham o ar circulando entre os módu­los. Os ventiladores também faziam o ar atravessar diversos fil­tros e purificadores, que removiam o dióxido de carbono, a água e as partículas em suspensão.

—Esses filtros HEPA devem ter capturado cada ovo ou larva em um prazo de 15 minutos — disse Luther, apontando para o diagrama dos filtros de partículas aéreas de alta eficiência. — O sistema tem uma eficiência de 99,9 por cento. Tudo maior que um terço de mícron deve ter sido filtrado.

—Supondo-se que os ovos tenham ficado em suspensão — disse Emma. — O problema é que eles aderem às superfícies. E eu os vi se moverem. Podem entrar em fendas e se esconder atrás de painéis onde não podemos vê-los.

—Demoraria meses para que desmontássemos cada painel para procurá-los. Mesmo assim, provavelmente deixaríamos pas­sar algum.

—Esqueça o desmonte dos painéis. É inútil. Vou trocar o resto dos filtros HEPA. Amanhã, volte a verificar as amostras de micróbios no ar. Temos de supor que funcionará. Mas se essas larvas entraram nos condutores elétricos, jamais as encontrare­mos. — Ela suspirou, tão exausta que tinha dificuldade para ra­ciocinar. — Seja lá o que fizermos, talvez não adiante nada. Pode ser tarde demais.

—Definitivamente, já é muito tarde para Diana — disse Luther, baixinho.

As hemorragias haviam aparecido no branco dos olhos de Diana naquele mesmo dia. Agora, ela estava confinada no módu­lo de serviço russo. Uma cortina plástica fora instalada na abertu­ra da escotilha e ninguém podia entrar ali sem máscara e óculos de proteção. Um exercício inútil, pensou Emma. Todos respira­vam o mesmo ar e todos haviam tocado em Nicolai. Talvez esti­vessem todos infectados.

-—Temos de considerar o módulo de serviço russo como irremediavelmente contaminado — disse Emma.

—Mas é o único módulo ainda com energia plena. Não podemos fechá-lo inteiramente.

—Então acho que sei o que temos de fazer.

Luther suspirou em desalento.

—Outra EVA.

—Precisamos restaurar a energia nesta extremidade — disse ela. — Vocês têm de terminar os reparos na junta rotacional ou estaremos à beira da catástrofe. Se algo mais der errado com o que resta do nosso fornecimento de energia, poderemos perder o Controle Am­biental. Ou os computadores de Orientação e Navegação.

Era o que os russos costumavam chamar de situação de ataúde. Sem energia para se orientar, a estação começaria a rodar des­controladamente.

Mesmo que restauremos a energia, isso não resolve nosso problema real disse Luther. A biocontaminação.

Se conseguirmos contê-la na extremidade russa...

Mas ela está incubando larvas neste exato momento! Ela é como uma bomba, esperando para explodir.

Vamos ejetar o corpo dela assim que morrer disse Emma. Antes de expelir qualquer ovo ou larva.

Pode ser tarde demais. Nicolai tossiu aqueles ovos quando ainda estava vivo. Se esperarmos Diana morrer...

O que está sugerindo, Luther? A voz de Griggs assustou a ambos, que se voltaram para ele.

Ele os observava da escotilha, o rosto brilhando nas sombras.

Esta sugerindo que a ejetemos enquanto ainda estiver viva?

Luther aprofundou-se ainda mais em meio à penumbra, como se recuando do ataque.

Meu Deus, não era isso que eu estava dizendo.

Então, o que você estava dizendo?

Apenas que sabemos que as larvas estão dentro dela. Sabemos que é uma questão de tempo.

Talvez estejam dentro de todos nós. Talvez estejam dentro de você. Crescendo, desenvolvendo-se neste exato momento. De­vemos ejetar o seu corpo?

Se for para evitar que isso se espalhe... Veja, todos sabemos que ela vai morrer. Não há nada que possamos fazer a respeito. Precisamos pensar com antecipação...

—Cale-se! — Griggs atravessou o módulo habitacional e agarrou a camisa de Luther.

Ambos se chocaram contra a parede oposta e voltaram a ricochetear. Rodaram diversas vezes no ar, Luther tentando se livrar das mãos de Griggs, Griggs recusando-se a soltá-lo.

— Parem! — gritou Emma. — Griggs, solte-o!

Griggs soltou Luther. Ambos se afastaram, ainda ofegantes. Emma se posicionou como um juiz entre os dois.

—Luther está certo — disse ela para Griggs. — Temos de pensar adiante. Talvez não desejemos fazer isso, mas não temos escolha.

—E se fosse você, Watson? — rebateu Griggs. — Como se sentiria ao ouvir-nos discutir o que fazer com o seu corpo? Quão rapidamente poderemos ensacá-lo e nos livrarmos de você?

—Eu desejaria que estivessem fazendo tais planos! Há outras três vidas em jogo, e Diana sabe disso. Estou fazendo de tudo para mantê-la viva, mas neste instante não sei como agir. Tudo o que posso fazer é enchê-la de antibióticos e esperar que Houston nos dê algumas respostas. Ao que eu saiba, estamos por conta própria aqui em cima. Temos de nos preparar para o pior!

Griggs balançou a cabeça. Seus olhos estavam com as bordas avermelhadas, o rosto pesaroso.

—Como isso pode ficar pior? — murmurou ele.

Emma não respondeu. Em vez disso, olhou para Luther e leu os seus próprios pensamentos nos olhos dele. O pior ainda está por vir.

— ISS, o Cirurgião deseja falar — disse o Capcom.

—Prossiga, ISS.

Jack?

Emma ficou desapontada ao ouvir a voz de Todd Cutler.

—Sou eu, Emma. Infelizmente, Jack não estará aqui no JSC hoje. Ele e Gordon foram para a Califórnia.

Droga, Jack, pensou Emma.Eu preciso de você.

—Aqui embaixo, todos concordamos com a EVA — disse Todd. — Precisa ser feita, e logo. A minha primeira pergunta para você é: como está Luther Ames, física e mentalmente? Ele consegue fazê-lo?

—Está cansado. Todos estamos cansados. Mal dormimos nas últimas 24 horas. A limpeza está nos mantendo ocupados.

—Se dermos a ele um dia de descanso, ele conseguiria reali­zar a EVA?

—No momento, um dia de descanso soa como um sonho impossível.

—Mas seria tempo bastante?

Ela pensou um instante.

—Creio que sim. Ele só precisa pôr o sono em dia.

-—Tudo bem. Aqui vai a minha segunda pergunta. Você estaria pronta para uma EVA?

Emma fez uma pausa, surpresa.

—Você quer que eu o acompanhe?

—Não acreditamos que Griggs esteja pronto para isso. Ele tem evitado se comunicar com a Terra. Nossos psicólogos acham que ele está muito instável a essa altura.

—Ele está sofrendo, Todd. E está muito amargurado por não nos deixarem voltar para casa. Talvez você não saiba, mas ele e Diana são...

Ela fez uma pausa.

—Sabemos disso. E tais emoções têm comprometido seriamente a sua capacidade. Isso tornaria uma EVA perigosa. Por isso você precisa ser a parceira de Luther.

—E quanto ao traje? O outro EMU é grande demais para mim.

—Há um traje Orlan-M na velha Soyuz. Foi feito para Elena Savitskaya e foi deixado a bordo há várias missões. Elena tinha quase o mesmo peso e altura que você. Deve caber.

—Será minha primeira EVA.

—Você passou por treinamento WET-F. Você consegue. Luther só precisa de sua assistência.

—E quanto à minha paciente? Se eu estiver lá fora fazendo uma EVA, quem cuidará dela?

Griggs pode trocar as intravenosas, cuidar das necessida­des dela.

—E se ocorrer uma crise médica? E se ela entrar em convulsão?

Todd disse em voz baixa:

—Ela está morrendo, Emma. Não acreditamos que você pos­sa fazer algo.

—Isso por que não me deram nenhuma informação útil com que trabalhar! Estão mais interessados em manter a estação viva! Parece que se importam mais com os malditos painéis solares do que com a tripulação. Precisamos de uma cura, Todd, ou vamos todos morrer aqui em cima.

—Não temos uma cura. Não ainda.

—Então nos levem para casa!

—Você acha que nós queremos deixá-los aí em cima? Acha que temos escolha? Aqui parece o alto-comando nazista! Há ba­bacas da Força Aérea em todo o Controle da Missão e...

Houve um silêncio súbito.

—Cirurgião? — disse Emma. — Todd?

Ainda sem resposta.

Capcom, perdi contato com Cirurgião — disse ela. — Preciso que a comunicação seja restaurada.

Uma pausa e, então:

—Aguarde, ISS.

Ela esperou por uma eternidade. Quando a voz de Todd voltou, estava contida. Intimidada, pensou Emma.

—Eles estão nos ouvindo, não é mesmo? — perguntou.

—Afirmativo.

—Isto supostamente é uma PMC! Uma conferência particular!

—Nada mais é particular. Lembre-se disso.

Ela engoliu em seco, contendo a ira.

—Muito bem. Vou pular as reclamações. Apenas me diga o que sabem sobre esse organismo. Diga-me o que posso usar con­tra ele.

—Infelizmente, não temos muito a dizer. Acabo de falar com o USAMRIID. Com um certo Dr. Isaac Roman, que está a cargo do projeto Quimera. As notícias dele não são boas. Todos os tes­tes com antibióticos e antielmínticos falharam. Ele diz que a Qui­mera tem tanto DNA estrangeiro que agora está mais perto do genoma de um mamífero do que de qualquer outra coisa. O que quer dizer que qualquer droga que usarmos contra ele vai matar os nossos tecidos também.

—Tentaram drogas contra o câncer? Esta coisa se multiplica tão rapidamente que está se comportando como um tumor. Po­demos atacá-lo desta forma?

—O USAMRIID tentou antimitóticos, esperando que pudessem matá-lo durante a fase de divisão celular. Infelizmente, as doses necessárias eram tão altas que também acabaram matando o hospedeiro. Toda a mucosa gastrintestinal dissolveu-se. Os ani­mais hospedeiros tiveram hemorragia.

A pior morte imaginável, pensou Emma. Hemorragia maciça no estômago e nos intestinos. Sangue vertendo da boca e do reto. Ela já vira uma morte assim na Terra. No espaço, seria ainda mais terrível, glóbulos gigantes de sangue preenchendo a cabine como balões vermelhos, manchando todas as superfícies, cada membro da tripulação.

—Então, nada deu certo — disse ela.

Todd não disse nada.

—Então não há nada? Nenhum tipo de cura que não mate o hospedeiro?

—Só mencionaram uma coisa. Mas Roman acha que é ape­nas um efeito temporário, não uma cura.

—Qual o tratamento?

—Uma câmara hiperbárica. Requer um mínimo de dez atmosferas de pressão. O equivalente a mergulhar em uma pro­fundidade de 90 metros. Animais infeccionados mantidos nes­sas condições de alta pressão ainda estão vivos seis dias após a exposição.

—Tem de ser um mínimo de dez atmosferas?

—Menos que isso, a infecção prossegue. O hospedeiro morre.

Eia emitiu um gemido de frustração.

—Mesmo que pudéssemos aumentar a pressão de nosso ar, dez atmosferas é mais do que esta estação aguenta.

—Até mesmo duas vai estressar o casco — disse Todd. —Fora isso, você precisaria de uma atmosfera de hélio e oxigênio. Você não poderá reproduzir ta! atmosfera na estação. Foi por isso que não quis mencionar a alternativa. Em sua situação, é uma in­formação inútil. Já pensamos na possibilidade de mandar uma câmara hiperbárica para a ISS, mas um equipamento assim volu­moso, algo capaz de produzir tamanha pressão, precisaria ser mandado no compartimento de carga da Endeavour. O problema é que ela já saiu do processamento horizontal. Demoraria um mí­nimo de duas semanas para carregar e lançar a câmara. Isso tam­bém significaria acoplar o veículo orbital à ISS. Expor a Endeavour e sua tripulação à contaminação. — Ele fez uma pausa. — O USAMRIID diz que isso não é uma opção.

Ela ficou em silêncio, a frustração transformando-se em rai­va. Sua única esperança, uma câmara hiperbárica, exigiria que voltasse à Terra, Aquela também não era uma opção.

—Tem de haver algo que possamos fazer com tal informação — disse ela. — Explique-me: por que a terapia hiperbárica fun­ciona? Por que o USAMRIID pensou em experimentar isso?

—Fiz a mesma pergunta ao Dr. Roman.

—E o que ele respondeu?

—Que este é um organismo novo e bizarro. Que exige que consideremos terapias não convencionais.

—Ele não respondeu à sua pergunta.

—Foi tudo o que ele me disse.

Dez atmosferas de pressão era perto do limite da tolerância humana. Emma era uma ávida mergulhadora, mas nunca ousara ir mais fundo que 35 metros. Uma profundidade de 90 metros era apenas para os mergulhadores mais fortes e experientes. Por­que o USAMRIID testara pressões tão extremas?

Devem ter um motivo, pensou. Algo que sabem sobre este orga­nismo os fez achar que funcionaria.

Algo que não nos disseram.

 

O motivo de Gordon Obie ser conhecido como Es­finge nunca foi tão evidente como durante seu vôo até San Diego. Eles pegaram um dos jatos T-38 em Ellington Field, com Obie nos controles e Jack apertado no único banco de passageiro da aeronave. O fato de não terem trocado palavra du­rante o vôo não era de surpreender. O T-38 não estimula as con­versas, uma vez que passageiro e piloto sentam-se um atrás do outro como ervilhas em uma vagem. Mas mesmo durante a esca­la de abastecimento em El Paso, quando ambos saíram para esticar as pernas depois de uma hora e meia de aperto, Obie conti­nuou calado. Apenas uma vez, quando estavam na beira da pista bebendo Dr. Peppers compradas na máquina do hangar, ele fez um comentário espontâneo. Pouco depois do meio-dia, olhou para o sol com olhos semicerrados e disse:

— Se ela fosse minha mulher, eu também estaria apavorado. Então, jogou a lata de refrigerante vazia na lixeira e voltou para o jato.

Depois que aterrissaram em Lindbergh Field, Jack assumiu o volante do carro alugado e rumaram para o norte pela 1-5 a cami­nho de La Jolla. Gordon não disse quase nada, limitando a olhar pela janela. Jack sempre achara que Gordon era mais máquina do que ser humano e imaginou aquele cérebro computadorizado re­gistrando a paisagem como bits de dados: COLINA. VIADUTO. CONJUNTO HABITACIONAL. Embora Gordon já tivesse sido astronauta, ninguém na corporação realmente o conhecia. Ele comparecia religiosamente a todos os eventos sociais, mas ficava ensimesmado, uma figura quieta e solitária, nunca bebendo algo mais forte que seu favorito Dr. Pepper. Parecia tranquilo com a própria mudez, aceitava-a como parte de sua personalidade, as­sim como aceitava suas orelhas comicamente protuberantes e seus péssimos cortes de cabelo. Se ninguém realmente conhecia Gordon Obie, era porque ele não via motivo para se revelar.

Foi por isso que aquele comentário em El Paso surpreendeu Jack. Se fosse minha mulher, eu também estaria apavorado.

Jack não podia imaginar a Esfinge apavorada, assim como não podia imaginá-la casada. Ao que ele sabia, Gordon sempre fora solteiro.

Quando subiram a estrada costeira para La Jolla, a névoa da tarde já avançava do mar para a terra. Quase perderam a entrada do SeaScience. O acesso era sinalizado por uma pequena placa, e a estrada mais adiante parecia levar a um bosque de eucaliptos. Quase um quilômetro além da entrada, avistaram o edifício, um complexo surreal, quase uma fortaleza de concreto branco volta­da para o mar.

Uma mulher com avental de laboratório recebeu-os na mesa da segurança.

Rebecca Gould — disse ela, apertando-lhes as mãos. — Trabalho para Helen. Falei com vocês esta manhã.

Cabelo curto, corpulenta, Rebecca podia passar por qualquer gênero. Até mesmo sua voz grave era ambígua.

Pegaram o elevador para descerem ao subsolo.

— Realmente não sei por que insistiram em vir